GENETICALLY OPTIMIZED MICROORGANISM FOR THE PRODUCTION OF MOLECULES OF INTEREST

专利摘要:
The invention relates to a genetically modified microorganism expressing a functional RuBisCO type I or II enzyme and a phosphoribulokinase (PRK), and wherein the glycolysis pathway is at least partially inhibited, said microorganism being genetically modified to produce an exogenous molecule and / or overproducing an endogenous molecule. According to the invention the oxidative branch of the pentose phosphate pathway can also be at least partially inhibited. The invention also relates to the use of such a genetically modified microorganism, for the production or overproduction of a molecule of interest and methods of synthesis or bioconversion of molecules of interest.
公开号:FR3062394A1
申请号:FR1750694
申请日:2017-01-27
公开日:2018-08-03
发明作者:Cedric Boisart；Nicolas Morin
申请人:Enobraq；
IPC主号:

专利说明:

Holder (s): trusted.
ENOBRAQ simpliO joint stock company Request (s) for extension:
® Agent (s): CABINET LTL S.A.S. LAW TECH LINK.
FR 3 062 394 - A1 ® GENETICALLY OPTIMIZED MICROORGANISM FOR THE PRODUCTION OF MOLECULES OF INTEREST.
(57) The invention relates to a genetically modified microorganism expressing a functional RuBisCO type I or II enzyme and a functional phosphoribulokinase (PRK), and in which the glycolysis pathway is at least partially inhibited, said microorganism being genetically modified so as to produce an exogenous molecule and / or to overproduce an endogenous molecule. According to the invention, the oxidative branch of the pentose phosphate pathway can also be at least partially inhibited. The invention also relates to the use of such a genetically modified microorganism for the production or overproduction of a molecule of interest and to methods of synthesis or bioconversion of molecules of interest.
i
Microorganism genetically optimized for the production of molecules of interest
Field of the invention
The invention relates to a genetically modified microorganism capable of using carbon dioxide as an at least partial carbon source for the production of molecules of interest. More particularly, the invention relates to a microorganism in which at least the glycolysis pathway is at least partially inhibited. The invention also relates to methods for the production of at least one molecule of interest using such a microorganism.
State of the art
For several years, many microbiological processes have been developed to allow the production of molecules of interest in large quantities.
Thus, fermentation processes are used to produce molecules by a microorganism from a source of fermentable carbon, such as glucose.
Bioconversion processes have also been developed to allow a microorganism to convert a co-substrate, which cannot be assimilated by said microorganism, into a molecule of interest. Again, a source of carbon is needed, no longer for the actual production of the molecule of interest, but for the production of cofactors, and more particularly NADPH, which may be necessary for bioconversion. In general, the production yield by such microbiological processes is low mainly due to the need for cofactors and the difficulty of balancing the redox metabolic reactions. There is also the problem of the cost price of such molecules, since a source of carbon assimilable by the microorganism is always necessary. In other words, currently to produce a molecule of interest with a microbiological process, it is necessary to provide a molecule (glucose, or other), certainly of less industrial value, but which is enough to make the production of certain molecules not economically interesting.
At the same time, carbon dioxide (CO ₂ ), whose emissions into the atmosphere are constantly increasing, is little or not used in current microbiological processes, while its consumption by microorganisms for the production of molecules of interest would not only reduce production costs, but also respond to certain ecological issues.
There is therefore still a need for microbiological processes to allow the production of molecules of interest in large quantities and with lower production costs than with current processes.
Summary of the invention
The advantage of using genetically modified non-photosynthetic microorganisms to be able to capture CO ₂ and use it as the main carbon source, in the same way as plants and photosynthetic microorganisms has already been demonstrated. Thus, microorganisms modified so as to express a RuBisCO (Ribulose 1,5 bisphosphate carboxylase / oxygenase - EC 4.1.1.39) and a PRK (phosphoribulokinase - EC 2.7.1.19) functional so as to be able to thus reproduce a partial Calvin cycle and convert the ribulose 5 phosphate into two molecules of 3-phosphoglycerate by capture of one molecule of carbon dioxide have been developed.
By working on the solutions provided by the Calvin cycle to produce molecules of interest using CO2 as a carbon source, the inventors had the idea of coupling part of the Calvin cycle (PRK / RuBisCO) to an inhibition at least partial glycolysis, in order to increase the production yield of molecules of interest. In addition, in order to increase the consumption of exogenous CO2 during the production of molecules of interest, the inventors had the idea of also at least partially inhibiting the oxidative branch of the pentose phosphate pathway. The microorganisms thus developed make it possible to produce on a large scale and with an industrially interesting yield a large number of molecules of interest, such as amino acids, organic acids, terpenes, terpenoids, peptides, fatty acids, polyols, etc.
The subject of the invention is therefore a genetically modified microorganism expressing a functional RuBisCO enzyme and a phosphoribulokinase (PRK), and in which the glycolysis pathway is at least partially inhibited, said microorganism being genetically modified so as to produce an exogenous molecule and / or to overproduce an endogenous molecule.
In a particular embodiment, the genetically modified microorganism has an oxidative branch of the pentose phosphate pathway also at least partially inhibited.
The invention also relates to the use of a genetically modified microorganism according to the invention, for the production or overproduction of a molecule of interest, preferably chosen from amino acids, peptides, proteins, vitamins, sterols, flavonoids, terpenes, terpenoids, fatty acids, polyols and organic acids.
The present invention also relates to a biotechnological process for producing or overproducing at least one molecule of interest, characterized in that it comprises a step of culturing a genetically modified microorganism according to the invention, under conditions allowing synthesis or the bioconversion, by said microorganism, of said molecule of interest, and optionally a step of recovery and / or purification of said molecule of interest.
It also relates to a process for producing a molecule of interest comprising (i) the insertion of at least one sequence coding for an enzyme involved in the synthesis or bioconversion of said molecule of interest in a recombinant microorganism according to the invention , (ii) culturing said microorganism under conditions allowing expression of said enzyme and optionally (iii) recovering and / or purifying said molecule of interest.
Description of the figures
Figure 1: General diagram of glycolysis, the pentose phosphate route and the Entner-Doudoroff route;
Figure 2: Schematic representation of the inhibition of the glycolysis pathway, according to the invention;
Figure 3: Schematic representation of the inhibition of the glycolysis pathway, combined with the inhibition of the oxidative branch of the pentose phosphate pathway, according to the invention.
Detailed description of the invention
Definitions
The terms “recombinant microorganism”, “modified microorganism” and “recombinant host cell” are used herein interchangeably and denote microorganisms which have been genetically modified to express or to overexpress endogenous nucleotide sequences, to express heterologous nucleotide sequences, or who have impaired expression of an endogenous gene. By "alteration" is meant that the expression of the gene, or level of an RNA molecule or equivalent RNA molecules encoding one or more polypeptides or polypeptide subunits, or the activity of one or more polypeptides or polypeptide subunits is regulated, so that expression, level or activity is greater or less than that observed in the absence of modification.
It is understood that the terms "recombinant microorganism", "modified microorganism" and "recombinant host cell" refer not only to the particular recombinant microorganism, but to the offspring or potential offspring of such a microorganism. Certain modifications being able to occur in the following generations, due to a mutation or environmental influences, this offspring may not be identical to the mother cell, but it is still understood within the framework of the term as used here.
In the context of the invention, an at least partially “inhibited” or “inactivated” metabolic pathway is understood to be an altered metabolic pathway, which can no longer unfold correctly in the microorganism considered, compared to the same wild microorganism (not genetically modified to inhibit said metabolic pathway). In particular, the metabolic pathway can be interrupted, leading to the accumulation of an intermediate metabolite. Such an interruption can be obtained for example by inhibition of the enzyme necessary for the degradation of an intermediate metabolite of the metabolic pathway considered and / or by inhibition of the expression of the gene coding for this enzyme. The metabolic pathway can also be attenuated, i.e. slowed down. Such attenuation can be obtained for example by partial inhibition of one or more enzymes intervening in the metabolic path considered and / or by partial inhibition of the expression of a gene coding for at least one of these enzymes and / or by playing on the cofactors necessary for certain reactions. The expression “at least partially inhibited metabolic pathway” means that the level of the metabolic pathway considered is reduced by at least 20%, more preferably at least 30%, 40%, 50%, or more, compared to the level in a wild microorganism. The reduction may be greater, and in particular be at least greater than 60%, 70%, 80%, 90%. According to the invention, the inhibition can be total, in the sense that the metabolic pathway considered is no longer used at all by said microorganism. According to the invention, such inhibition can be temporary or permanent.
According to the invention, the expression “inhibition of the expression of a gene” is understood to mean the fact that said gene is no longer expressed in the microorganism considered or that its expression is reduced, compared to the wild microorganism (not genetically modified to inhibit gene expression), leading to the absence of production of the corresponding protein or to a significant drop in its production, and in particular to a drop greater than 20%, more preferably 30%, 40%, 50%, 60% , 70%, 80%, 90%. In one embodiment, the inhibition can be total, that is to say that the protein encoded by said gene is no longer produced at all. The inhibition of the expression of a gene can in particular be obtained by deletion, mutation, insertion and / or substitution of one or more nucleotides in the gene considered. Preferably, the inhibition of gene expression is obtained by complete deletion of the corresponding nucleotide sequence. According to the invention, any method of inhibiting a gene, known per se to those skilled in the art and applicable to a microorganism can be used. For example, inhibition of gene expression can be obtained by homologous recombination (Datsenko et al., Proc Natl Acad Sci USA. 2000; 97: 6640-5; Lodish et al., Molecular Cell Biology 4th ed 2000. WH Lreeman and Company. ISBN 0-7167-3136-3); random or directed mutagenesis to modify the expression of a gene and / or the activity of the encoded protein (Thomas et al., Cell. 1987; 51: 503-12); modification of a promoter sequence of the gene to alter its expression (Kaufmann et al., Methods Mol Biol. 2011; 765: 275-94. doi: 10.1007 / 978-l-61779-197-0_16); targeting induces local lesions in the genomes (TILLING); conjugation, etc. Another particular approach is gene inactivation by insertion of a foreign sequence, for example by transposon mutagenesis using mobile genetic elements (transposons), of natural or artificial origin. According to another preferred embodiment, the inhibition of gene expression is obtained by knockout techniques. Inhibition of gene expression can also be achieved by gene silencing using interfering, ribozyme or antisense RNA (Daneholt, 2006. Nobel Prize in Physiology or Medicine). In the context of the present invention, the term interfering RNA or RNAi designates any RNAi molecule (for example single-stranded RNA or double-stranded RNA) which can block the expression of a target gene and / or facilitate the degradation of mRNA correspondents. Inhibition of the gene can also be obtained by genomic editing methods which make it possible to directly make genetic modifications to a given genome, via the use of zinc finger nucleases (Kim et al., PNAS; 93: 1156-1160 ), effector nucleases of the transcription activator type, known as “TALEN” (Ousterout et al., Methods Mol Biol. 2016; 1338: 27-42. doi: 10.1007 / 978-14939-2932-0_3), of a system combining Cas9 nucleases with short grouped and regularly spaced palindromic repeats called 'CRISPR' (Mali et al., Nat Methods. 2013 Oct; 10 (10): 957-63. doi: 10.1038 / nmeth.2649), or more meganucleases (Daboussi et al., Nucleic Acids Res. 2012. 40: 6367-79). Inhibition of gene expression can also be achieved by inactivation of the protein encoded by said gene.
The term “NADPH-dependent” or “NADPH-consuming” biosynthesis or bioconversion means, in the context of the invention, all of the biosynthesis or bioconversion pathways in which one or more enzymes require the concomitant supply of electrons obtained by the oxidation of a NADPH cofactor. The “NADPH-dependent” biosynthesis or bioconversion pathways relate in particular to the synthesis of amino acids (eg arginine, lysine, methionine, threonine, proline, glutamate, homoserine, isoleucine, valine), terpenoids and terpenes (eg farnesene), vitamins and precursors (eg pantoate, pantothenate, transneurosporene, phylloquinone, tocopherols), sterols (eg squalene, cholesterol, testosterone, progesterone, cortisone), flavonoids (eg frambinone, vestinone), organic acids (eg coumaric acid, 3-hydroxypropionic acid), polyols (eg sorbitol, xylitol, glycerol), polyamines (eg spermidine), aromatic molecules from stereospecific hydroxylation, via an NADP-dependent cytochrome p450 (eg phenylpropanoids, terpenes, lipids, tannins, aromas, hormones).
The term "exogenous" as used herein with reference to various molecules (nucleotide sequences, peptides, enzymes, etc.), denotes molecules which are not normally or naturally found in and / or produced by the microorganism considered. Conversely, the term "endogenous" or native in reference to various molecules (nucleotide sequences, peptides, enzymes, etc.), designates molecules which are normally or naturally found in and / or produced by the microorganism considered.
Microorganisms
The invention provides genetically modified microorganisms for the production of a molecule of interest, endogenous or exogenous.
By “genetically modified” microorganism is meant that the genome of the microorganism has been modified so as to integrate a nucleic sequence coding for an enzyme intervening in the biosynthesis or bioconversion pathway of a molecule of interest, or coding for a biologically active fragment. of it. Said nucleic acid sequence may have been introduced into the genome of said microorganism or one of its ancestors, by any suitable molecular cloning method. In the context of the invention, the genome of the microorganism means all the genetic material contained in said microorganism, including extrachromosomal genetic material contained for example in plasmids, episomes, synthetic chromosomes, etc. The nucleic acid sequence introduced can be a heterologous sequence, that is to say one which does not exist in the natural state in said microorganism, or a homologous sequence. Advantageously, a transcriptional unit comprising the nucleic sequence of interest, placed under the control of one or more promoter (s), is introduced into the genome of the microorganism. Such a transcriptional unit also advantageously comprises the usual sequences such as transcriptional terminators, and where appropriate other elements for regulating transcription.
Promoters usable in the context of the present invention include constitutive promoters, namely promoters which are active in most cell states and environmental conditions, as well as inducible promoters which are activated or repressed by exogenous physical or chemical stimuli , and which therefore induce a variable level of expression depending on the presence or absence of these stimuli. For example, when the microorganism is a yeast, it is possible to use a constitutive promoter, such as that of a gene from TEF1, TDH3, PG1F PGK, ADH1. Examples of inducible promoters which can be used in yeast are the tetO-2, G AL 10, GAL10-CYC1, PH05 promoters.
In general, the genetically modified microorganism according to the invention has the following characteristics:
Expression of a functional RuBisCO (EC 4.1.1.39);
Expression of a functional PRK (EC 2.7.1.19);
At least partial inhibition of glycolysis; and
Expression of at least one gene participating in the synthesis and / or bioconversion of a molecule of interest, and / or inhibition of at least one gene encoding a competitive activity in the synthesis and / or bioconversion of a molecule of interest.
According to the invention, any microorganism can be used. Preferably, the microorganism is a eukaryotic cell, preferably chosen from yeasts, fungi, microalgae or a prokaryotic cell, preferably a bacterium or cyanobacterium.
In one embodiment, the genetically modified microorganism according to the invention is a yeast, preferably chosen from ascomycete yeasts (Spermophthoraceae and Saccharomycetaceae), basidiomycete yeasts (Leucosporidium, Rhodosporidium, Sporidiobolus, Filobasidium, and Filobasidiella) and yeasts with Fungi imperfecti (Sporobolomycetaceae. and Cryptococcaceae). Preferably, the genetically modified yeast according to the invention belongs to the genus Pichia, Kluyveromyces, Saccharomyces, Schizosaccharomyces, Candida, Lipomyces, Rhodotorula, Rhodosporidium, Yarrowia, or Debaryomyces. More preferably, the yeast genetically modified according to the invention is chosen from Pichia pastoris, Kluyveromyces lactis, Kluyveromyces marxianus, Saccharomyces cerevisiae, Saccharomyces carlsbergensis, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbucisisbucisiscesbombisisaccharides Candida tropicalis, Rhodotorula glutinis, Rhodosporidium toruloides, Yarrowia lipolytica, Debaryomyces hansenii and Lipomyces starkeyi.
In another embodiment, the genetically modified microorganism according to the invention is a fungus, and more particularly a "filamentous" fungus. In the context of the invention, "filamentous fungi" denotes all the filamentous forms of the Eumycotina subdivision. For example, the genetically modified fungus according to the invention belongs to the genus Aspergillus, Trichoderma, Neurospora, Podospora, Endothia, Mucor, Cochiobolus or Pyricularia. Preferably, the genetically modified fungus according to the invention is chosen from Aspergillus nidulans, Aspergillus niger, Aspergillus awomari, Aspergillus oryzae, Aspergillus terreus, Neurospora crassa, Trichoderma reesei, and Trichoderma viride.
In another embodiment, the genetically modified microorganism according to the invention is a microalga. In the context of the invention, the term "microalgae" means all of the microscopic algae of the eukaryotic type, preferably belonging to the classes or superclasses of Chlorophyceae, Chrysophyceae, Prymnesiophyceae, Diatoms or Bacillariophyta, Euglénophyceae, Rhodophyceae, or Trebouxiophea. Preferably, the microalgae genetically modified according to the invention are chosen from Nannochloropsis sp. (e.g. Nannochloropsis oculata, Nannochloropsis gaditana, Nannochloropsis salina), Tetraselmis sp. (e.g. Tetraselmis suecica, Tetraselmis chuii), Chlorella sp. (e.g. Chlorella salina, Chlorella protothecoides, Chlorella ellipsoidea, Chlorella emersonii, Chlorella minutissima, Chlorella pyrenoidosa, Chlorella sorokiniana, Chlorella vulgaris), Chlamydomonas sp. (e.g. Chlamydomonas reinhardtii) Dunaliella sp. (eg Dunaliella tertiolecta, Dunaliella salina), Phaeodactulum tricornutum, Botrycoccus braunii, Chroomonas salina, Cyclotella crypt., Ettlia texensis, Euglena gracilis, Gymnodinium nelsoni, Elaematococcus pluvialis, Isochrysis Galblor Nitzschia laevis, Onoraphidium sp., Pavlova lutheri, Phaeodactylum tricornutum, Porphyridium cruentum, Scenedesmus sp. (e.g. Scenedesmus obliquuus, Scenedesmus quadricaula, Scenedesmus sp.), Stichococcus bacillaris, Spirulina platensis, Thalassiosira sp.
In one embodiment, the genetically modified microorganism according to the invention is a bacterium, preferably chosen from the phyla Acidobacteria, Actinobacteria, Aquificae, Bacterioidetes, Chlamydiae, Chlorobi, Chloroflexi, Chrysiogenetes, Cyanobacteria, Deferribacteres, Deinococcus-Thermus, Dictyogl , Firmicutes, Fusobacteria, Gemmatimonadetes, Nitrospirae, Planctomycetes, Proteobacteria, Spirochaetes, Thermodesulfobacteria, Thermomicrobia, Thermotogae, or Verrucomicrobia. Preferably, the genetically modified bacterium according to the invention belongs to the genus Acaryochloris, Acetobacter, Actinobacillus, Agrobacterium, Alicyclobacillus, Anabaena,
Anacystis, Anaerobiospirillum, Aquifex, Arthrobacter, Arthrospira, Azobacter, Bacillus, Brevibacterium, Burkholderia, Chlorobium, Chromatium, Chlorobaculum, Clostridium, Corynebacterium, Cupriavidus, Cyanothece, Enterobacter, Deinococcus, Erinobacter, Globobacteria, Erinobacter, Globinobacteria, Erinobacter, Globia, Globia, Globia, Globacteria Lactobacillus, Lactococcus, Mannheimia, Mesorhizobium, Methylobacterium, Microbacterium, Microcystis, Nitrobacter, Nitrosomonas, Nitrospina, Nitrospira, Nostoc, Phormidium, Prochlorococcus, Pseudomonas, Ralstonia, Rhizobium, Rhodobacter, Rhodobacter, Rhodobacterium Staphylococcus, Streptomyces, Synechoccus, Synechocystis, Thermosynechococcus, Trichodesmium, or Zymomonas. More preferably, the genetically modified bacterium according to the invention is chosen from the species Agrobacterium tumefaciens, Anaerobiospirillum succiniciproducens, Actinobacillus succinogenes, Aquifex aeolicus, Aquifex pyrophilus, Bacillus subtilis, Bacillus amyloliquefacines, Brevibacterium ammoniagenes, Brevibacter, Brevibacterium , Clostridium acetobutylicum, Clostridium beigerinckii, Corynebacterium glutamicum, Cupriavidus necator, Cupriavidus metallidurans, Enterobacter sakazakii, E. coli, Gluconobacter oxydans, Hydrogenobacter thermophilus, Klebsiella oxytoca, Lactococcus lactis, Lactobacillus plantarum, Mannheimia succiniciproducens, Mesorhizobium loti, Pseudomonas aeruginosa, Pseudomonas mevalonii, Pseudomonas pudica, Pseudomonas putida, Pseudomonas fluorescens, Rhizobium etli, Rhodobacter capsulatus, Rhodobacter sphaeroides, Rhodospirillum rubrum, Salmonella enterica, Salmonella typhi, Salmonel typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Streptomyces coelicolor, Zymomonas mobilis, Acaryochloris marina, Anabaena variabilis, Arthrospira platensis, Arthrospira maxima, Chlorobium tepidum, Chlorobium tepidum, Chlorobium tepidum. Nostoc punctiforme, Prochlorococcus marinus, Synechococcus elongatus, Synechocystis sp., Thermosynechococcus elongatus, Trichodesmium erythraeum, and Rhodopseudomonas palustris.
Expression of a functional RuBisCO and P RK
According to the invention, the microorganism can naturally express a functional RuBisCO and PRK. This is the case for example with photosynthetic microorganisms, such as microalgae or cyanobacteria.
There are several forms of RuBisCO in nature (Tabita et al., J Exp Bot. 2008; 59 (7): 151524. doi: 10.1093 / jxb / erm361). Forms I, II and III catalyze the carboxylation and oxygenation reactions of ribulose 1,5-biphosphate. Form I is present in eukaryotes and bacteria. It consists of two types of subunits: large subunits (RbcL) and small subunits (RbcS). The functional enzyme complex is a hexadecamer consisting of eight L subunits and eight S subunits. The correct assembly of these subunits also requires the intervention of at least one specific chaperone: RbcX (Liu et al. , Nature. 2010 Jan 14; 463 (7278): 197-202. Doi: 10.1038 / nature08651). Form II is mainly found in proteobacteria, archaea and dinoflagellate algae. Its structure is much simpler: it is a dimer formed from two identical RbcL subunits. Depending on the organism, the genes coding for a RuBisCO type I can be called rbcL / rbcS (for example, Synechococcus elongatus), or cbxLC / cbxSC, cfxLC / cfxSC, cbbL / cbbS (for example, Cupriavidus necator). According to the body, the genes coding for a type II RuBisCO are generally called cbbM (for example, Rhodospirillum rubrum). Form III is present in archaea. It is generally found in the form of dimers of RbcL subunit, or in pentamers of dimers. Depending on the body, the genes encoding a RuBisCO type III can be called rbcL (for example, Thermococcus kodakarensis), cbbL (for example, Elaloferax sp.).
Two classes of PRKs are known: the class I enzymes which are found in proteobacteria are octamers, while the class II enzymes which are found in cyanobacteria and in plants are tetramers or dimers. Depending on the organism, the genes coding for PRK can be called prk (for example, Synechococcus elongatus), prkA (for example, Chlamydomonas reinhardtiï), prkB (for example, Escherichia coli), prkl, prk2 (for example, Leptolyngbya sp.), cbbP (for example, Nitrobacter vulgaris) or cfxP (for example, Cupriavidus necator).
In the case where the microorganism used does not naturally express a functional RuBisCO and PRK, said microorganism is genetically modified to express a heterologous RuBisCO and PRK. Advantageously, in such a case, the microorganism is transformed so as to integrate into its genome one or more expression cassettes integrating the sequences coding for said proteins, and advantageously the appropriate transcriptional factors. Depending on the type of RuBisCO to be expressed, it may also be necessary to have one or more chaperone proteins expressed by the microorganism, in order to promote the proper assembly of the subunits forming the RuBisCO. This is particularly the case for RuBisCO type I, where the introduction and expression of genes coding for a specific chaperone 5 (Rbcx) and general chaperones (GroES and GroEL, for example) prove necessary to obtain a functional RuBisCO. Application WO2015 / 107496 describes in detail how to genetically modify a yeast so that it expresses a functional RuBisCO type I and a PRK. It is also possible to refer to the method described in GUADALUPE-MEDINA et al. (Biotechnology for Biofuels, 6, 125, 2013).
In one embodiment, the microorganism is genetically modified to express a RuBisCO type I. In another embodiment, the microorganism is genetically modified to express a RuBisCO type II. In another embodiment, the microorganism is genetically modified to express a type III RuBisCO.
Tables 1 and 2 below list, by way of example, sequences encoding RuBisCO and PRK which can be used to transform a microorganism so that it expresses functional RuBisCO and PRK.
Table 1: Examples of sequences coding for a RuBisCO
Uncomfortable GenBank Gl Organization rbcL BAD78320.1 56685098 Synechococcus elongatus rbcS BAD78319.1 56685097 Synechococcus elongatus cbbL2 CAJ96184.1 113529837 Cupriavidus necator cbbS P09658.2 6093937 Cupriavidus necator cbbM P04718.1 132036 Rhodospirillum rubrum cbbM Q21YM9.1 115502580 Rhodoferax ferrireducens cbbM Q479W5.1 115502578 Dechloromonas aromatica rbcL 093627.5 37087684 Thermococcus kodakarensis cbbL CQR50548.1 811260688 Haloferax sp. Arc-Hr
Table 2: Examples of sequences coding for a PRK
Uncomfortable GenBank Gl Organization Prk BAD78757.1 56685535 Synechococcus elongatus cfXP P19923.3 125575 Cupriavidus necator PRK P09559.1 125579 Spinacia oleracea cbbP P37100.1 585367 Nitrobacter vulgaris
Inhibition of glycolysis
According to the invention, the glycolysis pathway is at least partially inhibited, so that the microorganism is no longer able to use this metabolic pathway normally (FIG. 1 glycolysis). In other words, the microorganism no longer has the capacity to assimilate glucose in a similar way to a wild microorganism, in which the glycolysis pathway has not been inhibited (independently of any other genetic modification).
In a particular embodiment, the microorganism is genetically modified so as to completely or partially inhibit glycolysis downstream from the production of glyceraldehyde-3 -phosphate (G3 P).
For example, glycolysis is inhibited upstream of the production of 1,3-biphospho-D-glycerate (1,3-BPG) or upstream of the production of 3-phosphoglycerate (3PG).
Depending on the microorganism, the reactions involved between glyceraldehyde-3-phosphate (G3P) and 3-phosphoglycerate (3PG) can be managed (i) by two enzymes acting concomitantly, glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12, abbreviated GAPDH or more rarely G3PDH) and phosphoglycerate kinase (EC 2.7.2.3, abbreviated PGK), or (ii) by a single non-phosphorylating glyceraldehyde 3-phosphate dehydrogenase enzyme (EC 1.2.1.9, abbreviated GAPN).
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) catalyzes the reversible conversion of G3P to 1,3-biphospho-D-glycerate (1,3-BPG), using the NAD ⁺ / NADH couple as electron donor / acceptor depending on the direction of the reaction. Depending on the organism, the genes coding for GAPDH can be called gapA, gapB, gapC (eg Escherichia coli, Arabidopsis thaliana), GAPDH, GAPD, G3PD, GAPDHS (eg Homo sapiens), TDH1, TDH2, TDH3 (eg Saccharomyces cerevisiae ), gap, gap2, gap3 (eg Mycobacterium sp., Nostoc sp.).
Phosphoglycerate kinase (PGK) catalyzes the reversible conversion of 1,3-BPG to 3PG, using the ATP / ADP pair as a cofactor. Depending on the body, the genes coding for PGK can be called PGK, PGK1, PGK2, PGK3, pgkA, PGKB, PGKC, cbbK, cbbKC, cbbKP (e.g. Cupriavidus necator).
Non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase (GAPN) catalyzes the conversion of G3P to 3PG, without passing through 1,3-BPG. This reaction is catalyzed in the presence of the NADP ⁺ / NADPH cofactor pair which plays the role of electron acceptor. Depending on the organism, the genes coding for GAPN can be called GAPN (eg Bacillus sp., Streptococcus sp.), GAPN1 (eg Chlamydomonas sp.).
In a particular example, the microorganism is genetically modified so that the expression of the gene encoding glyceraldehyde 3-phosphate dehydrogenase is at least partially inhibited. Preferably, the expression of the gene is completely inhibited.
Alternatively or additionally, the expression of the gene encoding the phosphoglycerate kinase can also be at least partially inhibited. Preferably, the expression of the gene is completely inhibited.
Alternatively, the microorganism is genetically modified so that the expression of the gene encoding nonphosphorylating glyceraldehyde-3-phosphate dehydrogenase is at least partially inhibited. Preferably, the expression of the gene is completely inhibited.
Tables 3, 4 and 5 below list, by way of example, the sequences coding for a glyceraldehyde 3-phosphate dehydrogenase, a phosphoglycerate kinase and a non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase which can be inhibited depending on the microorganism target. Those skilled in the art know which gene corresponds to the enzyme of interest to be inhibited depending on the microorganism.
Table 3: Examples of sequences coding for a GAPDH
Uncomfortable GenBank Gl Organization gapA NP 416293.1 16129733 Escherichia coli TDH1 NP_012483.3 398364523 Saccharomyces cerevisiae TDH2 NP 012542.1 6322468 Saccharomyces cerevisiae TDH3 NP_011708.3 398366083 Saccharomyces cerevisiae gap CCE36949.1 378,544,675 Mycobacterium tuberculosis gap2 P34917.2 92090599 Nostoc sp
Table 4: Examples of sequences coding for a PGK
Uncomfortable GenBank Gl Organization Pgk AKL94701.1 831186507 Clostridium aceticum PGK1 NP 009938.2 10383781 Saccharomyces cerevisiae Pgk BAG04189.1 166089481 Microcystis aeruginosa PGKA AAG34561.2 22711882 Dictyostelium discoideum PGKB CAJ03534.1 68126221 Leishmania major cbbKC AAC43444.1 976365 Cupriavidus necator
Table 5: Examples of sequences coding for a GAPN
Uncomfortable GenBank Gl Organization gapN CUB58597.1 924094571 Bacillus subtilis GAPN NP 358622.1 933338 Streptococcus pneumoniae GAPN1 EDP03116.1 542583 Chlamydomonas reinhardtii
In general, the production of 3-phosphoglycerate (3PG) is no longer possible by means of glycolysis, or at least greatly reduced, in the genetically modified microorganism according to the invention.
In a particular embodiment, the microorganism is a yeast of the genus Saccharomyces cerevisiae in which the expression of the gene TDH1 (Gene ID: 853395), TDH2 (Gene ID: 853465) and / or TDH3 (Gene ID: 853106) is at less partially inhibited.
In another particular embodiment, the microorganism is a yeast of the genus Saccharomyces cerevisiae in which the expression of the PGK1 gene (Gene ID: 5230) is at least partially inhibited.
In another exemplary embodiment, the microorganism is a yeast of the genus Saccharomyces cerevisiae in which the expression of the gene PGK1 (Gene ID: 5230), the expression of the gene TDH1 (Gene ID: 853395), TDH2 (Gene ID: 853465 ) and / or the expression of the TDH3 gene (Gene ID: 853106) are at least partially inhibited.
In a particular embodiment, the microorganism is a bacterium of the genus Escherichia coli in which the expression of the gapA gene (Gene ID: 947679) is at least partially inhibited.
In another particular embodiment, the microorganism is a bacterium of the genus Escherichia coli in which the expression of the pgk gene (Gene ID: 947414) is at least partially inhibited.
In another exemplary embodiment, the microorganism is an E. coli bacterium in which the expression of the pgk gene (Gene ID: 947414), and / or the expression of the gapA gene (Gene ID: 947679) are at least partially inhibited.
According to the invention, the genetically modified microorganism, which expresses a functional RuBisCO and PRK, is on the other hand capable of producing 3PG by capturing CO ₂ , from ribulose-5-phosphate produced by the pentose phosphate pathways (FIG. 2).
Since the enzymes necessary for the metabolism of 3PG to pyruvate are not inhibited in the microorganism, the said microorganism can then metabolize 3PG so as to produce pyruvate and ATP.
Thus, the genetically modified microorganism is able to produce pyruvate and NADPH cofactors using CO2 as a complementary carbon source.
In the context of the invention, the term “complementary” carbon source is understood to mean the fact that the microorganism uses CO2 as a partial carbon source, in addition to the carbons supplied by fermentable sugars (glucose, galactose, sucrose, fructose, etc.), which constitute the majority, or main, source of carbon for the production of pyruvate.
Thus, the genetically modified microorganism according to the invention makes it possible to increase the carbon yield, by fixing and using the CO2 normally lost during the metabolism of glucose by the pentose phosphate phosphates, for the production of pyruvate (and subsequently molecules of interest).
Inhibition of the oxidative branch of the pentose phosphate pathway
In a particular embodiment, the genetically modified microorganism according to the invention is also modified so that the oxidative branch of the pentose phosphate pathway is also at least partially inhibited.
Preferably, the microorganism is genetically modified so as to inhibit the oxidative branch of the pentose phosphate pathway upstream from the production of ribulose-5phosphate (FIG. 1 - pentose phosphate pathway).
The interruption of the oxidative branch of the pentose phosphate pathway upstream from the production of ribulose-5-phosphate (Ru5P) specifically targets one or more reactions in the process of synthesis of Ru5P from glucose-6-phosphate (G6P ). This synthesis is generally catalyzed by the successive actions of three enzymes: (i) glucose-6phosphate dehydrogenase (EC. 1.1.1.49, abbreviated G6PDH), (ii) 6-phosphogluconolactonase (EC 3.1.1.31, abbreviated PGL), and (iii) 6-phosphogluconate dehydrogenase (EC 1.1.1.44, abbreviated PGD).
Glucose-6-phosphate dehydrogenase (G6PDH) catalyzes the first reaction of the pentose phosphate pathway, i.e. the oxidation of glucose-6-phosphate to 6phosphogluconolactone, with concomitant reduction of one NADP + molecule to NADPH. Depending on the organism, the genes coding for G6PDH can be called G6PD (for example in Homo sapiens), G6pdx (for example in Mus musculus), gsdA (for example in Aspergillus nidulans), zwf (for example in Escherichia coli), or ZWL1 (for example from Saccharomyces cerevisiae).
6-phosphogluconolactonase (PGL) is a hydrolase catalyzing the synthesis of 6phosphogluconate (6PGA) from 6PGL. Depending on the organism, the genes coding for PGL can be called pgl (for example in Escherichia coli, Synechocystis sp.) Pgls (for example in Rhodobacteraceae bacterium), or SOL (for example in Saccharomyces cerevisiae).
6-phosphogluconate dehydrogenase (PGD) is an oxidoreductase catalyzing the synthesis of Ru5P from 6PGA, with concomitant reduction of a molecule of NADP + to NADPH and emission of a molecule of CO ₂ . Depending on the organism, the genes coding for PGD can be called gnd (for example in Escherichia coli, _Saccharomyces cerevisiae), PGD (for example in Homo sapiens), gntZ (for example in Bacillus subtilis), or 6-PGDH (for example in Lactobacillus paracollinoides).
In a particular example, the microorganism is genetically modified so that the expression of the gene encoding glucose-6-phosphate dehydrogenase is at least partially inhibited. Preferably, the expression of the gene is completely inhibited.
Alternatively or additionally, the microorganism is genetically modified so that the expression of the gene encoding 6-phosphogluconolactonase is at least partially inhibited. Preferably, the expression of the gene is completely inhibited.
Alternatively or additionally, the microorganism is genetically modified so that the expression of the gene encoding 6-phosphogluconate dehydrogenase is at least partially inhibited. Preferably, the expression of the gene is completely inhibited.
Tables 6, 7 and 8 below list, by way of example, the sequences coding for a glucose 6-phosphate dehydrogenase, a 6-phosphogluconolactonase and 6-phosphogluconate dehydrogenase which can be inhibited depending on the target microorganism. Those skilled in the art know which gene corresponds to the enzyme of interest to be inhibited depending on the microorganism.
Table 6: Examples of sequences coding for a G6PDH
Uncomfortable GenBank Gl Organization zwf BAA15660.1 1736495 Escherichia coli ZWF1 NP 014158.1 6324088 Saccharomyces cerevisiae gsdA CAA54841.1 1523786 Aspergillus nidulans
Table 7: Examples of sequences coding for a PGL
Uncomfortable GenBank Gl Organization pgi BAA35431.1 4062334 Escherichia coli pgi BAK51770.1 339275283 Synechocystis Pgls KPQ07176.1 938272062 Rhodobacteraceae bacterium S0L3 KZV10901.1 1023943655 Saccharomyces cerevisiae
Table 8: Examples of sequences coding for a PGD
Uncomfortable GenBank Gl Organization gnd ALI40222.1 937519736 Escherichia coli GND1 EDN62420.1 151944127 Saccharomyces cerevisiae gntZ NP 391888.1 16081060 Bacillus subtilis 6-PGDH WP 054711110.1 938929230 Lactobacillus paracollinoides
In general, the production of ribulose-5-phosphate (Ru5P) is no longer possible via pentose phosphates, or at least greatly reduced, in the genetically modified microorganism according to the invention.
In a particular embodiment, the microorganism is a yeast of the genus Saccharomyces cerevisiae in which the expression of the ZWF1 gene is at least partially inhibited.
In a particular example, the yeast of the genus Saccharomyces cerevisiae is genetically modified so that the expression of the TDH1, TDH2, TDH3 and / or PGK1 genes, and the expression of the ZWF1 gene are at least partially inhibited.
In another particular embodiment, the microorganism is a bacterium of the genus Escherichia coli in which the expression of the zwf gene is at least partially inhibited.
In a particular example, the bacterium of the genus Escherichia coli is genetically modified so that the expression of the gapA and / or pgk genes, and the expression of the zwf gene are at least partially inhibited. According to the invention, the genetically modified microorganism, which expresses a functional RuBisCO and PRK, and whose glycolysis pathway and the oxidative branch of the pentose phosphate pathway are at least partially inhibited is no longer able to produce 3PG by the glycolysis route or by Ru5P by the oxidative branch of the pentose phosphate route. On the other hand, it is capable of producing Ru5P by diverting the production of fructose-6-phosphate (F6P) and / or glyceraldehyde-3-phosphate (G3P), produced at the start of glycolysis (upstream of inhibition). This production is notably possible thanks to the enzymes transketolase (EC 2.2.1.1), transaldolase (EC 2.2.1.2), ribose-5-phosphate isomerase (EC 5.3.1.6), etribulose-5-phosphate epimerase (EC 5.1.3.1) naturally present and active in microorganisms (Figure 3).
Since the enzymes necessary for the metabolism of 3PG to pyruvate are not inhibited in the microorganism according to the invention, said microorganism can then metabolize 3PG so as to produce pyruvate and ΓΑΤΡ.
Thus, the genetically modified microorganism is able to produce pyruvate using exogenous CO ₂ as a complementary carbon source.
Thus, the genetically modified microorganism according to the invention makes it possible to increase the carbon yield, by fixing and using exogenous CO2, for the production of pyruvate (and subsequently molecules of interest). Again, there is an increase in carbon yield.
Inhibition of the Entner-Doudoroff pathway
In a particular embodiment, the genetically modified microorganism according to the invention has an Entner-Doudoroff pathway, and this is at least partially inhibited. This pathway, mainly found in bacteria (especially Gram-), is an alternative to glycolysis and the pentose pathway for the production of pyruvate from glucose. More precisely, this pathway connects to the pathway of pentose phosphates at the level of P-gluconate to supply glycolysis at the level in particular of pyruvate.
Preferably, the microorganism is genetically modified so as to inhibit the reactions of the Entner-Doudoroff pathway downstream from the production of 6-phosphogluconate. This inhibition eliminates a possible competitive path, and ensures the availability of 6phosphogluconate as a substrate for PRK / RuBisCO engineering.
The interruption of the Entner-Doudoroff pathway downstream of the production of 6-phosphogluconate specifically targets one or more reactions in the process of synthesis of pyruvate from 6-phosphogluconate. This synthesis is initiated by the successive actions of two enzymes: (i) 6-phosphogluconate dehydratase ("EDD" - EC. 4.2.1.12), and (ii) 2dehydro-3-deoxy-phosphogluconate aldolase ("EDA" - EC 4.1.2.14).
6-phosphogluconate dehydratase catalyzes the dehydration of 6-phosphogluconate to 2keto-3-deoxy-6-phosphogluconate. Depending on the body, the genes coding for 6phosphogluconate dehydratase may be called edd (GenBank NP_416365, for example, in Escherichia coli), or ilvD (for example, in Mycobacterium sp.
2-dehydro-3-deoxy-phosphogluconate aldolase catalyzes the synthesis of a pyruvate molecule and a glyceraldehyde-3-phosphate molecule from the 2-keto-3-deoxy-6phosphogluconate produced by 6-phosphogluconate dehydratase . Depending on the organism, the genes coding for 2-dehydro-3-deoxy-phosphogluconate aldolase can be called eda (GenBank NP_416364, for example in Escherichia coli), or kdgA (for example in Thermoproteus tenax), or dgaL ( for example in Salmonella typhimurium).
In a particular example, the microorganism is genetically modified so that the expression of the gene encoding 6-phosphogluconate dehydratase is at least partially inhibited. Preferably, the expression of the gene is completely inhibited.
Alternatively or additionally, the microorganism is genetically modified so that the expression of the gene encoding 2-dehydro-3-deoxy-phosphogluconate aldolase is at least partially inhibited. Preferably, the expression of the gene is completely inhibited.
Tables 9 and 10 below list, by way of example, the sequences coding for a 6phosphogluconate dehydratase and a 2-dehydro-3-deoxy-phosphogluconate aldolase which can be inhibited depending on the target microorganism. Those skilled in the art know which gene corresponds to the enzyme of interest to be inhibited depending on the microorganism.
Table 9: Examples of sequences coding for an EDD
Uncomfortable GenBank Gl Organization edd NP 416365.1 16129804 Escherichia coli ilvD CND70554.1 893638835 Mycobacterium tuberculosis edd AJQ65426.1 764046652 Salmonella enterica
Table 10: Examples of sequences coding for an EDA
Uncomfortable GenBank Gl Organization eda AKF72280.1 817591701 Escherichia coli kdgA Q704D1.1 74500902 Tenax thermoproteus eda 068283.2 81637643 Pseudomonas aeruginosa
Generally, in this embodiment, the production of pyruvate is no longer possible via the Entner-Doudoroff route, or at least greatly reduced.
In a particular embodiment, the microorganism is a bacterium of the genus Escherichia coli in which the expression of the edd gene is at least partially inhibited.
In a particular example, the bacterium of the genus Escherichia coli is genetically modified so that the expression of the gapA, and edd genes is at least partially inhibited.
According to the invention, the genetically modified microorganism, which expresses a functional RuBisCO and PRK, and whose glycolysis pathway and the Entner-Doudoroff pathway are at least partially inhibited is no longer able to produce 3PG by the pathway glycolysis or pyruvate by the Entner-Doudoroff route. The carbon flow from glucose is therefore preferentially oriented towards PRK / RuBisCO engineering.
Production of molecules of interest
According to the invention, the genetically modified microorganism is transformed so as to produce an exogenous molecule of interest and / or to overproduce an endogenous molecule of interest.
In general, the genetic modifications made to the microorganism, as set out above, make it possible to improve the carbon yield of the synthetic and / or bioconversion pathways of molecules of interest.
In the context of the invention, an "improved" yield is understood in terms of the quantity of finished product. In general, the carbon yield corresponds in the context of the invention to the ratio of quantity of finished product / quantity of fermentable sugar, in particular by weight. According to the invention, the carbon yield is increased in microorganisms genetically modified according to the invention, compared to wild microorganisms, placed under identical culture conditions. Advantageously, the carbon yield is increased by 2%, 5%, 10%, 15%, 18%, 20%, or more. The genetically modified microorganism according to the invention can produce a greater quantity of the molecules of interest (finished product) compared to the heterologous molecules produced by a genetically modified microorganism simply to produce or overproduce this molecule. According to the invention, the genetically engineered microorganism can also overproduce an endogenous molecule compared to the wild microorganism. The overproduction of an endogenous molecule is mainly understood in terms of quantities. Advantageously, the genetically modified microorganism produces at least 20%, 30%, 40%, 50%, or more by weight of the endogenous molecule than the wild microorganism. Advantageously, the microorganism according to the invention is genetically modified so as to produce or overproduce at least one molecule among amino acids, terpenoids, terpenes, vitamins and / or vitamin precursors, sterols, flavonoids, organic acids , polyols, polyamines, aromatic molecules obtained from stereospecific hydroxylation, via an NADP-dependent cytochrome p450, etc.
In a particular example, the microorganism is genetically modified to overproduce at least one amino acid, preferably chosen from arginine, lysine, methionine, threonine, proline, glutamate, homoserine, isoleucine and valine .
In a particular example, the microorganism is genetically modified to produce or overproduce molecules from the terpenoids pathway, such as famesene, and from the terpene pathway.
In a particular example, the microorganism is genetically modified to produce or overproduce a vitamin or a precursor, preferably chosen from pantoate, pantothenate, transneurosporene, phylloquinone and tocopherols.
In a particular example, the microorganism is genetically modified to produce or overproduce a sterol, preferably chosen from squalene, cholesterol, testosterone, progesterone and cortisone.
In a particular example, the microorganism is genetically modified to produce or overproduce a flavonoid, preferably chosen from frambinone and vestinone.
In a particular example, the microorganism is genetically modified to produce or overproduce an organic acid, preferably chosen from coumaric acid, 3-hydroxypropionic acid and citric acid.
In a particular example, the microorganism is genetically modified to produce or overproduce a polyol, preferably chosen from sorbitol, xylitol and glycerol.
In a particular example, the microorganism is genetically modified to produce or overproduce a polyamine, preferably spermidine.
In a particular example, the microorganism is genetically modified to produce or overproduce an aromatic molecule from stereospecific hydroxylation, via an NADP-dependent cytochrome p450, preferentially chosen from phenylpropanoids, terpenes, lipids, tannins, flavors, hormones.
In the case where the molecule of interest is obtained by bioconversion, the genetically modified microorganism is advantageously cultured in a culture medium comprising the substrate to be converted. In general, the production or overproduction of a molecule of interest by a genetically modified microorganism according to the invention is obtained by culturing said microorganism in an appropriate culture medium, known to those skilled in the art.
The term "appropriate culture medium" generally designates a sterile culture medium providing essential nutrients or beneficial to the maintenance and / or growth of said microorganism, such as carbon sources; nitrogen sources such as ammonium sulfate; sources of phosphorus, for example, potassium phosphate monobasic; trace elements, for example, copper, iodide, iron, magnesium, zinc or molybdate salts; vitamins and other growth factors such as amino acids or other growth promoters. Antifoam can be added as needed. According to the invention, this suitable culture medium can be chemically defined or complex. The culture medium can thus be of identical or similar composition to a synthetic medium, as defined by Verduyn et al., (Yeast. 1992. 8: 501-17), adapted by Visser et al., (Biotechnology and bioengineering. 2002. 79: 674-81), or commercially available such as the YNB medium (Yeast Nitrogen Base, MP Biomedicals or Sigma-Aldrich).
In particular, the culture medium can comprise a simple carbon source, such as glucose, galactose, sucrose, molasses, or the by-products of these sugars, optionally supplemented with CO ₂ as a carbon co-substrate. According to the present invention, the simple carbon source must allow the normal growth of the microorganism of interest, b is also possible, in certain cases, to use a complex carbon source, such as lignocellulosic biomass, straw from rice, or starch. The use of a complex carbon source generally requires pretreatment before use.
In a particular embodiment, the culture medium contains at least one carbon source from monosaccharides such as glucose, xylose or arabinose, disaccharides such as sucrose, organic acids such as acetate, butyrate, propionate or valerate to promote different kinds of polyhydroxyalkanoate (PHA), treated or untreated glycerol.
Depending on the molecules to be produced and / or overproduced, it is possible to play on the supply of nutritional factors (N, O, P, S, K +, Mg2 +, Fe2 +, Mn, Co, Cu, Ca, Sn; Koller and al., Microbiology Monographs, G.-Q. Chen, 14: 85-119, (2010)). This is particularly the case for promoting the synthesis and intracellular accumulation of PHA including PHB.
According to the invention, any culture method allowing the production on an industrial scale of molecules of interest can be envisaged. Advantageously, the culture is done in bioreactors, in particular in batch, fed-batch and / or continuous culture mode. Preferably, the culture control associated with the production of the molecule of interest is in fed-batch mode corresponding to a controlled supply of one or more substrates, for example via the addition of a concentrated glucose solution whose concentration can be between 200 gL-1 and 700 gL-1. A controlled supply of vitamins during the process can also be beneficial to productivity (Alfenore et al., Appl Microbiol Biotechnol. 2002. 60: 67-72). It is also possible to add a solution of ammonium salts to limit the nitrogen supply.
The fermentation is generally carried out in bioreactors, with possible stages of solid and / or liquid precultures in Erlenmeyers, with an appropriate culture medium containing at least one simple carbon source and / or an exogenous CO ₂ supply, necessary for production. of the molecule of interest.
Generally, the culture conditions of the microorganisms according to the invention are easily adaptable by a person skilled in the art, depending on the microorganism and / or the molecule to be produced / overproduced. For example, the culture temperature is in particular for yeasts between 20 ° C and 40 ° C, preferably between 28 ° C and 35 ° C, and more particularly around 30 ° C for S. cerevisiae. The culture temperature is in particular between 25 ° C and 35 ° C, preferably 30 ° C for Cupriavidus necator.
The subject of the invention is therefore also the reuse of a genetically modified microorganism according to the invention, for the production or overproduction of a molecule of interest, preferably chosen from amino acids, peptides, proteins, vitamins, sterols, flavonoids, terpenes, terpenoids, fatty acids, polyols and organic acids.
The subject of the invention is also a biotechnological process for producing at least one molecule of interest, characterized in that it comprises a step of culturing a genetically modified microorganism according to the invention, under conditions allowing the synthesis or the bioconversion, by said microorganism, of said molecule of interest, and optionally a step of recovery and / or purification of said molecule of interest.
In a particular embodiment, the microorganism is genetically modified to express at least one enzyme involved in the synthesis of said molecule of interest.
In another particular embodiment, the microorganism is genetically modified to express at least one enzyme involved in the bioconversion of said molecule of interest.
The subject of the invention is also a method for producing a molecule of interest comprising (i) the insertion of at least one sequence coding for an enzyme involved in the synthesis or the bioconversion of said molecule of interest in a microorganism recombinant according to the invention, (ii) culturing said microorganism under conditions allowing expression of said enzyme and optionally (iii) recovering and / or purifying said molecule of interest.
For example, citrate can be overproduced by a fungus, in particular a filamentous fungus, such as cyP Aspergillus niger, genetically modified to express a functional PRK and RuBisCO, and in which the expression of the pgk genes (Gene ID: 4982539 ) and gsdA (Gene ID: 4979751) is at least partially inhibited.
Similarly, it is possible to produce farnesene by a yeast such as a yeast of the genus Saccharomyces cerevisiae genetically modified to express a functional PRK and RuBisCO, a farnesene synthase and in which the expression of a PGK1 gene (Gene ID: 5230) is at least partially inhibited.
It is also possible to overproduce glutamate by a bacterium, such as a bacterium of the genus Escherichia coli, genetically modified to express a functional PRK and a RuBisCO, and in which the expression of the gapA gene (Gene ID: 947679) is at least partially inhibited.
EXAMPLES
Example 1: Bioinformatics analysis
a) Calculation of theoretical yields
i) Comparison of the carbon fixation yields from glucose between a wild strain using the pentose phosphate pathway and glycolysis, and a strain modified according to the invention
In order to evaluate the benefit provided by the modifications described according to the invention, theoretical yield calculations were carried out on the basis of the stoichiometry of the reactions involved.
Two scenarios were analyzed: the improvement brought by PRK-RuBisCO (i) engineering in a strain inhibited for glycolysis on the yield of a NADPH-dependent biosynthesis pathway (for example, farnesene synthesis), and (ii) in a strain inhibited for glycolysis and for the oxidative branch of the pentose phosphate pathway on the yield of a biosynthetic pathway of interest (for example, citrate synthesis).
As part of the improvement of the NADPH-dependent biosynthetic pathways, the theoretical balance of the formation of NADPH and glyceraldehyde-3-phosphate (G3-P) from glucose by the pentose phosphate route was calculated according to l equation below (1):
(1) 3 Glucose + 5 ATP + 6 NADP ⁺ + 3 H2O 5 G3-P + 5 ADP + 6 NADPH + 11H ⁺ + 3 CO2
Going down to the formation of pyruvate from G3P, we arrive at the following balance:
(2) 3 Glucose + 5 ADP + 6 NADP ⁺ + 5 NAD ⁺ + 5Pi 5 Pyruvate + 5 ATP + 6 NADPH + 5 NADH + 11H ⁺ + 3 CO ₂ + 2 H ₂ O
If we normalize the balance for one mole of glucose, we obtain the following yield:
(3) Glucose + 1.67 ADP + 2 NADP ⁺ + 1.67 NAD ⁺ + 1.67 Pi 1.67 Pyruvate + 1.67 ATP + 2 NADPH + 1.67 NADH + 3.67 H ⁺ + CO ₂ + 0.67 H ₂ O
Thus, using pentose phosphates, 1.67 moles of pyruvate and 2 moles of NADPH are produced from one mole of glucose. One mole of carbon, on the other hand, is lost by decarboxylation, during the formation of ribulose-5-phosphate by 6 phosphogluconate dehydrogenase (EC 1.1.1.44). In comparison, the formation of pyruvate by the glycolysis route gives the following yield:
(4) Glucose + 2 ADP + 2 NAD ⁺ + 2 Pi 2 Pyruvate + 2 ATP + 2 NADH + 2 H ⁺ + 2 H ₂ O
The theoretical maximum yield of pyruvate production by the pentose phosphate route is therefore 0.82 gpyruvate / ggiucose (g of synthesized pyruvate, per g of glucose consumed), while it is 0.98 gpyruvate / ggiucose by the route of glycolysis.
By integrating PRK / RuBisCO engineering into an inhibited strain for glycolysis (for example APGKl in the context of the yeast S. cerevisiae), the carbon fixation flux is redirected towards the oxidative branch of the pentose phosphate pathway, then towards PRK / RuBisCO engineering (see Figure 2). This flow is attached to the end of the glycolysis pathway, at the level of the formation of 3-phosphoglycerate (3PG), with the following yield:
(5) Glucose + 2 ATP + 2 NADP ⁺ + 2 H ₂ O 2 3PG + 2 ADP + 2 NADPH + 6 H ⁺
Going down to the formation of pyruvate from 3PG, we arrive at the following balance:
(6) Glucose + 2 NADP ⁺ 2 Pyruvate + 2 NADPH + 4 H ⁺
The integration of the modifications according to the invention into a microorganism makes it possible to recover the carbon molecule otherwise lost by decarboxylation in the pentose pathway. The theoretical maximum yield of carbon fixation is therefore 0.98 gpyruvate / ggiucose, which makes it possible to improve by 20.5% the yield obtained by the production of pyruvate by the pentose phosphates, while producing NADPH.
In a second case (see Figure 3), PRK / RuBisCO engineering is integrated into a strain that is both inhibited for glycolysis (for example APGKl in the context of the yeast S. cerevisiae), and for the branch oxidative of the pentose phosphate pathway (for example AZWF1 in the context of the yeast S. cerevisiae). The theoretical balance of the formation of NADPH and 3-phosphoglycerate (3PG) from glucose then becomes (7) 2.5 Glucose + 6 ATP + 3 CO ₂ + 3 H ₂ O 6 3PG + 6 ADP + 12 H ⁺
Going down to the formation of pyruvate from 3PG, we arrive at the following balance (8) 2.5 Glucose + 3 CO ₂ -> 6 Pyruvate + + 3 H ₂ O + 6 H ⁺
If we normalize the balance for one mole of glucose, we obtain the following yield:
(9) Glucose + 1.2 CO ₂ 2.4 Pyruvate + 1.2 H ₂ O + 2.4 H ⁺
The integration of the modifications according to the invention makes it possible to fix 1.2 additional carbon molecules per mole of glucose consumed. The corresponding theoretical maximum yield is 1.17 gpyruvate / ggiucose, or ca. 20% improvement compared to the carbon fixation yield of glycolysis.
ii) Application to citrate production
In a second case, the calculation is applied to the production of citrate in the yeast S. cerevisiae, in a wild strain and in a strain modified according to the invention integrating a PRK / RuBisCO engineering and deleted for the PGK1 gene so to inhibit the glycolysis pathway, and for the ZWF1 gene to inhibit the oxidative branch of the pentose pathway.
The production of citrate from pyruvate can be summarized by the following balance equation:
(11) 2 Pyruvate + ATP + NAD ⁺ + 3 H ₂ O + HCO ₃ Citrate + ADP + NADH + CO ₂ + Pi + 2H ⁺
This synthesis does not require NADPH, but 2 moles of pyruvate. Optimally, a wild strain obtains these 2 moles of pyruvate by glycolysis, from one mole of glucose according to equation (4), with the following balance:
(12) Glucose + ADP + 3 NAD ⁺ + Pi + 2 H ₂ O Citrate + ATP + 3 NADH + 5 H ⁺
The corresponding gcitrate / ggiucose yield is 1.07
In the context of a strain modified according to the invention, inhibited for the glycolysis pathway and the pentose phosphate pathway, the 2 pyruvates required are obtained with only 0.83 mole of glucose (cf. equation 9), with the following balance sheet :
(13) 0.83 Glucose + CO ₂ + ATP + NAD ⁺ + 3 H ₂ O Citrate + ADP + NADH + Pi + 5 H ⁺
The corresponding gcitrate / ggiucose yield is 1.28, ie a maximum theoretical increase of approximately 20% compared to the yield of the wild strain.
b) Simulation of biosynthesis yields by flow balance analysis
In a bioinformatics approach, analyzes of the “flow balance analysis” type (ABF) were also carried out to simulate the impact of the modifications described according to the invention on the yield of different biosynthesis pathways.
ABFs rely on mathematical models to simulate metabolic networks at the genome level (Orth et al., Nat Biotechnol. 2010; 28: 245-248). The reconstructed networks contain the known metabolic reactions of a given organism and integrate the needs of the cell, in particular to ensure cell maintenance, or growth. ABFs make it possible to calculate the flow of metabolites through these networks, making it possible to predict theoretical growth rates as well as production yields of metabolites.
z) Procedure
The ABF simulations were performed with the OptFlux software (Rocha et al., BMC Syst Biol. 2010 Apr 19; 4:45. Doi: 10.1186 / 1752-0509-4-45), and the metabolic model of Saccharomyces cerevisiae ÎMM904 ( Mo et al., BMC Syst Biol. 2009 Mar 25; 3: 37. Doi: 10.1186 / 1752-0509-337). This model has been modified to include the improvements described according to the invention, in particular a heterologous pathway for CO2 fixation with (i) addition of a PRK type reaction, (ii) addition of a RuBisCO type reaction.
In particular embodiments, the reactions necessary to simulate the production of molecules by heterologous routes have also been added to the model.
In a particular embodiment, a farnesene synthase type reaction (EC 4.2.3.46 or EC 4.2.3.47) was notably added for the heterologous production of farnesene.
In a second particular embodiment, the reactions of the acetoacetyl-CoA reductase (EC 1.1.1.36), and poly-3-hydroxybutyrate synthase (EC 2.3.1.B2 or 2.3.1.B5) type have been added to the model. to simulate a heterologous production pathway for β-hydroxyburyrate, the polyhydroxybutyrate monomer. The simulations were carried out by applying to the model a set of constraints reproducible by those skilled in the art, aiming to simulate the conditions of in vivo culture of a strain of S. cerevisiae under the conditions described according to the invention (for example, presence of non-limiting glucose in the medium, aerobic culture condition).
In particular embodiments, the simulations are carried out by virtually inactivating the reactions of the enzymes PGK1 (for example, glutamate, βhydroxybutyric acid, famesene) and ZWF1 (for example, production of citrate), so as to simulate the decreases in activity glycolysis and the pentose phosphate pathway, described according to the invention.
The simulations are carried out in parallel on a model of the “wild strain” type, unmodified, so as to assess the impact of the improvements described according to the invention on the production yield of the biosynthesis pathways tested.
ii) Results
The theoretical yields obtained and the improvement percentages provided by the invention are described in Table 11 below.
Table 11: Theoretical maximum production yields evaluated by ABF on a wild strain and a strain modified according to the patent modifications, for the production of different molecules.
Target molecule Theoretical maximum production yields with a wild strain Theoretical maximum production yields with a strain modified according to the invention Percentage improvement in theoretical mass yield gx / gGLuc provided by the invention MoIx / MoIgluc CMolx /CMoIgluc gx / gGLUC MoIx / MoIgluc CMolx /CMoIgluc gx / gGLUC Citrate 1 1 1.07 1.2 1.2 1.28 + 20% Glutamate 0.92 0.77 0.75 1.09 0.91 0.89 + 18.7% Β- acidhydroxybutyric 0.92 0.61 0.53 1.09 0.73 0.63 + 18.2% Farnesene 0.21 0.54 0.24 0.24 0.59 0.27 +12.5% MoIx / MoIgluc: moles of mo scales X produced, related to moles of g ucose consumed
CMolx / CMoIgluc: moles of carbon of molecule X produced, related to the moles of carbon of glucose consumed gx / gGLuc: g of molecule X produced, related to the g of glucose consumed.
EXAMPLE 2 Improvement of the Production of Farnesene in S. cerevisiae
A yeast strain Saccharomyces cerevisiae, CEN.PK 1605 (Mat a HIS3 leu2-3.112 trpl289 ura3-52 MAL.28c) from the commercial strain CEN.PK 113-7D (GenBank: JRIV00000000) is engineered to produce lossless NADPH CO ₂ and thus allow the improvement of the production of farnesene alpha from glucose.
a) Inactivation of the glycolysis pathway
For this, the glycolysis pathway was inactivated by deletion of the PGK1 gene. Once glycolysis is inhibited, the resulting yeast strain is no longer able to use glucose as a source of carbon and energy. It is therefore necessary to supply the biomass synthesis pathways with glycerol and the energy pathways with ethanol. The strains deleted for PGK1 are cultivated on YPGE (yeast extract peptone glycerol ethanol).
The deletion of the PGK1 gene was obtained in the following manner:
The coding phase of the G418 resistance gene, derived from the KanMX cassette contained on the plasmid pUG6 (P30114) - Euroscarf was amplified with the oligonucleotides CB 101 (SEQ ID No. 1) and CB 102 (SEQ ID No. 2) :
SEQ ID N ° 1: CB 101 (forward): 5’ACAGATCATCAAGGAAGTAATTATCTACTTTTTACAACAAATATAAAACAATGGG TAAGGAAAAGACTC ACGTTTC-3 ’
SEQ ID N ° 2: CB102 (reverse): 5’GGGAAAGAGAAAAGAAAAAAATTGATCTATCGATTTCAATTCAATTCAATTTAGA AAAACTCATCGAGCATCAAATGAAAC -3 ’
The underlined part of the oligonucleotides is perfectly homologous to the KanMX sequence and the rest of the sequence corresponds to the regions adjacent to the coding phase of the PGK1 gene on the genome of Saccaromyces cerevisiae so as to generate a PCR amplicon containing at the ends of the homologous recombination sequences of the PGK1 gene locus.
For the transformation reaction, the strain CEN.PK 1605 was cultivated in a volume of 50 ml of rich medium complex YPD (yeast extract peptone dextrose) at 30 ° C up to an optical density 600nm of 0.8. The cells were centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant was removed and the cells were resuspended in 25 ml of sterile water and centrifuged again for 5 minutes at 2500 rpm at room temperature. After removing the supernatant, the cells were resuspended in 400 µl of 100 mM sterile lithium acetate.
In parallel, a transformation mix was prepared in a 2 ml tube as follows: 250 μL of 50% PEG, 10 μL of “carrier” DNA at 5 mg / ml, 36 μL of 1 M lithium acetate, 5 or 10 μL of purified PCR reaction (deletion cassette) and water at 350 μl.
μΐ of resuspended cells were added to the transformation mixture and incubated at 42 ^° C. for 40 minutes in a water bath.
After incubation, the tube was centrifuged for 1 minute at 5000 rpm at room temperature and the supernatant was discarded. The cells were resuspended in 2 ml of YPGE (yeast extract peptone glycerol ethanol), transferred to a 14 ml tube and incubated for 2 hours at 30 ° C 200 rpm. The cells were then centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant was removed and the cells were resuspended in 1 ml of sterile water and centrifuged again for 1 minute and resuspended in 100 μΐ of sterile water and spread on YPGE + G418 180 pg / ml.
The colonies obtained were genotyped for validation of the deletion of the PGK1 gene and referenced EQ-0134 (CEN.PK1605 ApgL7 :: kan).
b) Introduction of PRK-RuBisCO enzymes
In order to reconstitute an alternative pathway to glycolysis and allow the Apgkl strain to grow on glucose, said strain was modified so as to allow combinatorial expression:
• a gene coding for a phosphoribulokinase PRK which is grafted on the pathway of pentose phosphates by consuming ribulose-5P to give ribulose-1.5bisP and • a RuBisCO type I (with the structural genes RbcL and RbcS and chaperones RbcX, GroES and GroEL). RuBisCO consumes ribulose-1.5bisP and one mole of CO ₂ to form 3-phosphoglycerate downstream of the PGK1 deletion in the glycolysis pathway.
This alternative route once again allows the strain to consume glucose as the main source of carbon and energy.
To produce apha-farnesene, the yeast lacks the alpha-farnesene synthase gene (AFS1; GenBank accession number AY182241).
Also, the seven genes necessary for PRK-RuBisCO engineering (Table 12) were cloned on three plasmid vectors capable of replicating autonomously, with compatible origins of replication and each carrying a complementation gene for different auxotrophies, allowing the selection of the strains containing the three plasmid constructs.
Two of these plasmids are monocopies, with an origin of replication of the Ars / CEN type and the third is multicopy with an origin of 2 μ.
Table 12: Description of the expression cassettes and of the composition of the plasmids
GenBank Codon optimization Promoter Terminator ori Auxotrophy marker Plasmids RbcL BAD78320.1 Yes TDH3p ADH1 2p URA3 pFPP45 pL4RbcS BAD78319.1 Yes TEFlp PGK1 2p URA3 pFPP45 pL4RbcX BAD80711.1 Yes TEFlp PGK1 ARS-CEN6 LEU2 pFPP56 GroES U00096 No PGIlp CYC1 ARS-CEN6 LEU2 pFPP56 GroEL AP009048 No TDH3 ADH1 ARS-CEN6 LEU2 pFPP56 PRK BAD78757.1 Yes Tet-OFF CYC1 ARS416-CEN4 TRP1 pFPP20 alphafarnésè ne synthas e AY182241 Yes PGIlp CYC1 2p URA3pL4 pL5 Empty Tet-OFF CYC1 ARS416-CEN4 TRP1 pCM185 Empty ARS-CEN6 LEU2 pFL36
Genes from Synechococcus elongatus such as RbcL, RbcS, RbcX and PRK (as described in WO 2015107496 A1) and alpha-famesene synthase from Malus domestica (Tippmann et al., Biotechnol Bioeng. 2016 Jan; l 13 (1 ): 72-81) have been optimized for the use of codons in the yeast Saccharomyces cerevisiae.
According to the protocol previously described, the strain EQ-0134 was cultivated in a volume of 50 ml of rich medium complex YPGE (yeast extract peptone glycerol ethanol) at 30 ° C and with the following transformation mix 250 pL of 50% PEG , 10 μL of “carrier” DNA at 5 mg / mL, 36 μL of 1 M lithium acetate, 10 μL (3 μg of a combination of pFPP45 + pFPP56 + pFPP20 or pL4 + pFPP56 + pFPP20 or pL5 + pFL36 + pCM185) and water at 350 μΐ.
μΐ of resuspended cells were added to the transformation mixture and incubated at 42 ^° C. for 40 minutes in a water bath. After incubation, the tube was centrifuged for 1 minute at 5000 rpm at room temperature and the supernatant was discarded. The cells were resuspended in 2 ml of YNB (yeast without nitrogen base supplemented with ammonium sulphate ¹ , glycerol ethanol) supplemented with a commercial medium CSM (MP Biomedicals) suitable for the selection markers, transferred to a tube of 14 mL and incubated for 2 hours at 30 ⁰ The final mix is spread on YNB + ammonium sulphate + CSM - LUW (uracil leucine, tryptophan in glycerol ethanol.
The clones obtained were genotyped for all of the engineering genes and adapted on YNB ammonium sulfate and glucose liquid medium.
• EQ-0153 (CEN.PK1605 A ^ H :: kan) (pFPP45 + pFPP56 + pFPP20) • EQ-0253 (CEN.PK1605 Apgkl :: kan) (pL4 + pFPP56 + pFPP20) • EQ-0353 (CEN.PK1605) (pL5 + pFL36 + pCM185)
Adaptation of strains EQ-0153 (PRK / RuBisCO / APGKl) and EQ-0253 (PRK / RuBisCO / APGKl + farnesene synthase) to growth on liquid medium YNB (yeast nitrogen base) with glucose and CO2.
The cultures in batch mode carried out in Erlenmeyer flasks are carried out with the appropriate culture medium and an exogenous supply of CO2 of 10%, in a shaken incubator (120 RPM, 30 ° C), with an inoculation at 0.05 DOôOOnm measured using an EON spectrophotometer (BioTek Instruments). The strain of interest is cultured on YNB + CSM-LUW medium with 10 g / L of glycerol and 7.5 g / L of ethanol, under conditions where the expression of PRK is not induced. Under these conditions, it is necessary to feed the strain upstream and downstream of the deletion of the PGK1 gene.
After obtaining a sufficient quantity of biomass, cultures of a volume greater than or equal to 50 ml in Erlenmeyer flask of at least 250 ml are seeded in order to adapt the strain to the use of PRK / RuBisCO engineering. This adaptation is carried out on the YNB + CSM-LUW culture medium with 20 g / L of glucose and an exogenous CO 2 supply as described above.
After observing a significant growth start, the strains are adapted to a minimum mineral medium free of amino acids and nitrogen base included in the CSM-LUW, i.e. only YNB with 20 g / L of glucose and an exogenous CO2 supply as described above.
c) Production of farnesene in Erlenmeyers
The strain EQ-0253 of Saccharomyces cerevisiae, deleted in the glycolytic pathway at the level of the PGK1 gene, is cultivated in order to produce farnesene by overproducing NADPH without loss of CO2, using a PRK and a RuBisCO.
This strain of interest is compared to a reference strain EQ-0353 producing farnesene following the introduction of a heterologous farnesene synthase, without deletion of PGK1 or addition of PRK and RuBisCO. Cultures in batch mode carried out in Erlenmeyer flasks are carried out under the conditions described above.
The farnesene concentration is quantified from the supernatant of fermentation musts. Briefly, the cell suspensions are centrifuged at 5000rpm for 5 minutes. The dodecane phase is diluted 10 times in hexane and is injected in GC-MS for analysis according to the protocol described in (Tippman et al. 2016).
A 10% increase in weight of the carbon yield (gram of farnesene per gram of glucose consumed) is observed for the strain EQ-0253 in comparison with the strain EQ0353.
EXAMPLE 3 Improvement of the Citrate Production in S. cerevisiae
a) Inactivation of the ZWF1 gene (chromosome: XIV; position 196426 to 197943, complementary strand)
The coding phase of the hygromycin B resistance gene, derived from the hphMX cassette (loxPpAgTEEl-hphMX-tAgTEEl-loxP) and contained on the plasmid pUG75 (P30671) - Euroscarf, is amplified with the oligonucleotides Sdzwfl and Rdzwfl (Table 13 ). This makes it possible to generate an Azwfl PCR amplicon containing at the ends sequences of homologous recombinations of the locus of the gene for the glucose-6-phosphate dehydrogenase ZWL1.
Table 13: Oligonucleotides
Last name sequence Sdzwfl AAGAGTAAATCCAATAGAATAGAAAACCACATAAGGCAAGATGGGTAAAAAGCCTGAACT (SEQ.ID # 3) CACCG Rdzwfl Al 1 1CAGTGACTTAGCCGATAAATGAATGTGCTTGCATTI 1 1 1 1ATTCCI 1 IGCCCTCGGAC (SEQ.ID # 4) G Sdpgkl ACAGATCATCAAGGAAGTAATTATCTACTTI 1 1ACAACAAATATAAAACAATGGGTAAGGA (SEQ.ID # 5) AAAGACTCACGTTTC Rdpgkl GGGAAAGAGAAAAGAAAAAAATTGATCTATCGATTTCAATTCAATTCAATTTAGAAAAACT (SEQ.ID # 6) CATCGAGCATCAAATGAAAC Sdidhl TCTCCCTATCCTCATTCTTCTCCCTTTTCCTCCATAATTGTAAGAGAAAAATGGGTACCACTC (SEQ.ID # 7) TTGACGACACGG Rdidhl AATTTGAACACACTTAAGTTGCAGAACAAAAAAAAGGGGAATTGTTTTCATTAGGGGCAG (SEQ.ID # 8) GGCATGCTCATGTAGAGC
The underlined part of the oligonucleotides corresponds to the part which is perfectly homologous to the sequence of the selection gene, the rest of the sequence corresponding to the regions adjacent to the coding phase of the target gene to be detected on the genome of Saccaromyces cerevisiae.
The previously described strain CEN.PK 1605 (Mat a HIS3 leu2-3.112 trpl-289 ura3-52 MAL.28c) derived from the commercial strain CEN.PK 113-7D (GenBank: JRIV00000000) is transformed with the PCR fragment Azwfl described here. -above.
For the transformation reaction, the strain CEN.PK 1605 is cultivated in a volume of 50 ml of rich medium complex YPD (yeast extract peptone dextrose, here glucose 20g / L) at 30 ° C until an optical density 600nm of 0.8 . The cells are centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant is removed and the cells are resuspended in 25 ml of sterile water and centrifuged again for 5 minutes at 2500 rpm at room temperature. After removing the supernatant, the cells are resuspended in 400 µl of 100 mM sterile lithium acetate.
At the same time, a transformation mix is prepared in a 2 ml tube as follows: 250 μL of 50% PEG, 10 μL of “carrier” DNA at 5 mg / ml, 36 μL of 1 M lithium acetate, 10 μL of purified PCR reaction (deletion cassette) and water at 350 μl.
μΐ of cells resuspended are added to the transformation mixture and incubated at 42 ^° C. for 40 minutes in a water bath. After incubation, the tube is centrifuged for 1 minute at 5000 rpm at room temperature and the supernatant is discarded. The cells are resuspended in 2 ml of YPD (yeast extract peptone glucose), transferred to a 14 ml tube and incubated for 2 hours at 30 ^° C. 200 revolutions per minute. The cells are then centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant is eliminated and the cells are resuspended in 1 ml of sterile water and centrifuged again for 1 minute and resuspended in 100 μl of sterile water and spread on YPD + HygromycinB 200 pg / ml.
The colonies obtained were genotyped for validation of the deletion of the ZWF1 gene and referenced EQSC-002 (CEN.PK 1605 Azwfl :: hph).
b) Inactivation of the IDH1 gene (Chromosome XIV; position 557920 to 559002, complementary strand)
The deactivation of this gene makes it possible to accumulate citrate (Rodriguez et al., Microb Cell Fact. 2016 Mar 3; 15:48).
The coding phase of the Nourseothricin resistance gene, derived from the natMX cassette (loxPpAgTEFl-natMX-tAgTEFl-loxP) contained on the plasmid pUG74 (P30670) - Euroscarf is amplified with the oligonucleotides Sdidhl and Rdidhl (table 13). This makes it possible to generate a didhl PCR amplicon containing, at the ends, sequences of homologous recombination of the locus of the gene for the subunit of the isocitrate dehydrogenase IDH1.
The previously described strain EQSC-002 (CEN.PK 1605 Azwfl :: / zp / z) is transformed with the PCR fragment for the inactivation of the IDH1 gene.
For the transformation reaction, the strain EQSC-002 is cultivated in a volume of 50 ml of rich medium complex YPD (yeast extract peptone dextrose, here glucose 20g / L) at 30 ° C until an optical density 600nm of 0.8. The cells are centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant is removed and the cells are resuspended in 25 ml of sterile water and centrifuged again for 5 minutes at 2500 rpm at room temperature. After removing the supernatant, the cells are resuspended in 400 µl of 100 mM sterile lithium acetate.
At the same time, a transformation mix is prepared in a 2 ml tube as follows: 250 μL of 50% PEG, 10 μL of “carrier” DNA at 5 mg / ml, 36 μL of 1 M lithium acetate, 10 μL of purified PCR reaction (deletion cassette) and water at 350 μl.
µl of resuspended cells are added to the transformation mixture and incubated at 42 ^° C. for 40 minutes in a water bath. After incubation, the tube is centrifuged for 1 minute at 5000 rpm at room temperature and the supernatant is discarded. The cells are resuspended in 2 ml of YPD (yeast extract peptone glucose), transferred to a 14 ml tube and incubated for 2 hours at 30 ^° C. 200 revolutions per minute. The cells are then centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant is eliminated and the cells are resuspended in 1 ml of sterile water and centrifuged again for 1 minute and resuspended in 100 μl of sterile water and spread on YPD + HygromycinB 200 pg / ml, 5Qpg / ml · Nourseothricin .
The colonies obtained were genotyped for validation of the deletion of the IDH1 gene and named EQSC-003 (CEN.PK 1605 Azwfl :: hph, Aidhl :: nat).
c) Inactivation of the PGK1 gene (chromosome III, position 137746 to 138996, sense strand)
The coding phase of the G418 resistance gene from the KanMX cassette (loxP-pAgTEElkanMX-tAgTEEl-loxP) contained on the plasmid pUG6 (P30114) - Euroscarf is amplified with the oligonucleotides Sdpgkl and Rdpgkl (Table 13) allowing the generation of an amplicon Apgkl PCR containing at the ends of the homologous recombination sequences of the locus of the 3-phosphoglycerate kinase gene PGK1.
The previously described strain EQSC-003 (CEN.PK 1605 Azwfl:: hph, Aidhl :: nat) is transformed with the PCR fragment for the activation of the PGK1 gene.
For the transformation reaction, the strain EQSC-002 is cultivated in a volume of 50 ml of rich medium complex YPD (yeast extract peptone dextrose, here glucose 20g / L) at 30 ° C until an optical density 600nm of 0.8. The cells are centrifuged for 5 minutes at 2500 rpm at room temperature. The supernatant is removed and the cells are resuspended in 25 ml of sterile water and centrifuged again for 5 minutes at 2500 rpm at room temperature. After removing the supernatant, the cells are resuspended in 400 µl of 100 mM sterile lithium acetate.
At the same time, a transformation mix is prepared in a 2 ml tube as follows: 250 μL of 50% PEG, 10 μL of “carrier” DNA at 5 mg / ml, 36 μL of 1 M lithium acetate, 10 μL of purified PCR reaction (deletion cassette) and water at 350 μl.
µl of resuspended cells are added to the transformation mixture and incubated at 42 ^° C. for 40 minutes in a water bath. After incubation, the tube is centrifuged for 1 minute at 5000 rpm at room temperature and the supernatant is discarded. The cells are resuspended in 2 mL of YPGE (yeast extract peptone glycerol 20g / L, ethanol 30g / L), transferred to a 14 mL tube and incubated for 2 hours at 30 ^° C. 200 rpm. The cells are then centrifuged for 1 minute at 5000 rpm at room temperature. The supernatant is eliminated and the cells are resuspended in 1 ml of sterile water and centrifuged again for 1 minute and resuspended in 100 μl of sterile water and spread on YPGE + HygromycinB 200 pg / ml, 5 () μg / mL Nour.seolhricin, 150pg / mL G418.
The colonies obtained were genotyped for the validation of the deletion of the PGK1 gene and referenced EQSC-004 (CEN.PK 1605 Azwfl :: hph, Mdhl :: nat, Apgkl :: kan). And EQSC-005 (CEN.PK 1605 Mdhl :: nat)
The six genes necessary for PRK-RuBisCO engineering (table 14 below) are cloned on three plasmid vectors capable of replicating autonomously, with compatible origins of replication and each carrying a different auxotrophy complementation gene, allowing the selection of the strains containing the three plasmid constructs (see WO 2015107496). Two of these plasmids are monocopies with an origin of replication of the ARS / CEN type and the third is multicopy with an origin of 2 μ.
Table 14: Description of the expression cassettes and of the composition of the plasmids
GenBank Codon optimization Promoter Terminateator ori Auxotrophy marker Plasmids RbcL BAD78320.1 Yes TDH3p ADH1 2p URA3 pFPP45 RbcS BAD78319.1 Yes TEFlp PGK1 2p URA3 pFPP45 RbcX BAD80711.1 Yes TEFlp PGK1 ARS-CEN6 LEU2 pFPP56 GroES U00096 No PGIlp CYC1 ARS-CEN6 LEU2 pFPP56 GroEL AP009048 No TDH3 ADH1 ARS-CEN6 LEU2 pFPP56 PRK BAD78757.1 Yes Tet-OFF CYC1 ARS416-CEN4 TRP1 pFPP20 Empty Tet-OFFARS416-CEN4 TRP1 pCM185 Empty TEFlp PGK1 2p URA3 V51TEF Empty ARS-CEN6 LEU2 pFL36
According to the protocol previously described, the strain EQSC-004 (CEN.PK 1605 Azwfl :: hph, Aidhl :: nat, ApgkI :: kan) was cultivated in a volume of 50 ml of medium rich in complex YPGE (yeast extract peptone glycerol ethanol ) at 30 ° C. and with the transformation mix according to 250 μL of 50% PEG, 10 μL of “carrier” DNA at 5 mg / ml, 36 μL of 1 M lithium acetate, 10 μL (3 μg) of of a combination of pFPP45 + pFPP56 + pFPP20 and water at 350 μl.
Similarly, the strain EQSC-005 (CEN.PK 1605 Aidhl :: nat) was cultured in a volume of 50 ml of rich medium complex YPGE (yeast extract peptone glycerol ethanol) at 30 ° C and with the following transformation mix 250 μL of 50% PEG, 10 μL of “carrier” DNA at 5 mg / ml, 36 μL of 1 M lithium acetate, 10 μL (3pg) of a combination of V51TEF + pFL36 + pCM185, for the control strain) and water at 350 pL.
µl of resuspended cells were added to the transformation mixture and incubated at 42 ^° C. for 40 minutes in a water bath. After incubation, the tube was centrifuged for 1 minute at 5000 rpm at room temperature and the supernatant was discarded. The cells were resuspended in 2 mL of YNB (yeast without nitrogen base supplemented with ammonium sulfate ¹ , glycerol ethanol) supplemented with a CSM commercial medium (MP Biomedicals) suitable for the selection markers and supplemented with glutamate at 50 mg / L, transferred to a 14 mL tube and incubated for 2 hours at 30 ⁰ The final mix is spread on YNB + ammonium sulphate + CSM - LUW (leucine, uracil, tryptophan) + glutamate at 50mg / L + 20g / L glycerol + 30g / L ethanol + doxycycline 2mg / L. The strains obtained are • EQSC-006 (CEN.PK 1605 Azwfl :: hph, Aidhl :: nat, Apgkl :: kan) (pFPP45 + pFPP56 + pFPP20) • EQSC-007 (CEN.PK 1605 Aidhl :: nat (pV51TEF + pFL36 + pCM185)
d) Extraction of metabolites
Adaptation of strains EQSC-006 and EQSC-007 to growth on liquid medium YNB (yeast nitrogen base) with glucose and CO2.
The cultures in batch mode carried out in Erlenmeyer flasks are carried out with the appropriate culture medium and an exogenous supply of CO2 of 10%, in a shaken incubator (120 RPM, 30 ° C), with an inoculation at 0.05 DOôOOnm measured using an EON spectrophotometer (BioTek Instruments). The strain of interest is cultured on YNB + CSM-LUW medium with 10 g / L of glycerol and 7.5 g / L of ethanol, + glutamate at 50 mg / L under conditions where the expression of PRK n is not induced.
After obtaining a sufficient quantity of biomass, cultures with a volume greater than or equal to 50 ml in Erlenmeyer flask of 250 ml minimum are seeded in order to effect the adaptation of the strain to the use of PRK / RuBisCO engineering. . This adaptation is carried out on the YNB + CSM-LUW culture medium with 20 g / L of glucose, glutamate at 50 mg / L and an exogenous CO 2 supply as described above.
After observing a significant growth start, the strains are adapted to a minimum mineral medium free of amino acids and nitrogen base included in the CSM-LUW, i.e. only YNB with 20 g / L of glucose glutamate at 50 mg / L and an exogenous CO2 supply as described above.
e) Citrate production in Erlenmeyers
The strain EQSC-006 of Saccharomyces cerevisiae, deleted in the glycolytic pathway at the level of the PGK1 gene, is cultivated in order to produce citrate by overproducing NADPH without loss of CO2, using a PRK and a RuBisCO.
This strain of interest is compared to a reference strain EQSC-007 producing citrate following the inactivation of the IDH1 gene, without deletion of PGK1 or ZWL1 or addition of PRK and RuBisCO. Cultures in batch mode carried out in Erlenmeyer flasks are carried out under the conditions described above.
The method described by Sasidharan et al. (PLoS One. 2012; 7 (8): e44283) was used. A culture of 5 DO units is lysed by breaking with beads in a suitable buffer. The metabolites are analyzed by liquid chromatography and mass spectrometry (LC-MS) on a ZIC-pHILIC type column on an Agilent 1200 Serial device.
The carbon yield (corresponding here to the ratio of gram of citrate obtained per gram of glucose consumed) is increased by 15% for the strain EQSC-006 006 (CEN.PK 1605 Azwfl :: hph, idhl :: nat, Apgkl :: kan ) (pFPP45 + pFPP56 + pFPP20) in comparison with the strain EQSC-005 (CEN.PK 1605 Mdhl :: nat).
EXAMPLE 4 Improvement of Glutamate Production in E. Coli
Deletion of the alpha-ketoglutarate dehydrogenase gene increases the production of glutamate (Usuda at al. J Biotechnol. 2010 May 3; 147 (1): 17-30. Doi: 10.1016 / j.jbiotec.2010.02.018).
In this example, an Escherichia coli K12 MG 1655 strain whose suc A gene has been deleted was therefore used. This strain comes from a gene deletion bank (Baba et al. Mol
Syst Biol. 2006; 2: 2006.0008) at Escherichia coli and supplied by the Coli Genetic Stock Center under the name JW0715-2 and with the reference 8786. (JW0715-2: MG1655 sucA :: Kan)
a) Elimination of the selection cassette by specific recombination of the FTR regions by the Flp recombinase
In order to be able to reuse the same deletion strategy as that used to construct the strain JW0715-2 above (Rodriguez et al., 2016), the selection cassette was deleted using a recombinase.
The plasmid p707-Llpe (supplied in the Quick & Easy E. coli Gene Deletion Red® / ET® Recombination by Gene bridges kit) is transformed by electroporation according to the kit protocol. The cells are selected on LB agar supplemented with 0.2% glucose, tetracycline 0.0003% and added with 0.3% L-arabinose. A counter selection of the clones obtained is carried out by checking that they are no longer capable of growing on the same medium supplemented with kanamycin 0.0015%.
The strain obtained is called EQ.EC002: MG1655 sucA
b) Deletion of the edd-eda operon encoding the Entner-Doudoroff metabolic pathway
The deletion of the edd-eda operon is carried out by homologous recombination and the use of the Quick & Easy E. coli Gene Deletion Red® / ET® Recombination Kit according to the protocol of the supplier Gene bridges.
1. Oligonucleotides designed to amplify an expression cassette for an ERT-PKG-gb2-neo-ERT resistance gene and having a 5 ′ sequence homologous on 50 nucleotides to the regions adjacent to the deletion locus, ie - say at positions 19320651932115 and 1934604-1934654 on the chromosome thus generating arms of recombination of the cassette on the bacterial genome on either side of the whole of the operon.
2. The Escherichia coli K-12 strain, EQ.EC002 is transformed by electroporation with the plasmid pRedET according to the kit protocol. The colonies obtained are selected on rich medium LB complex agar 0.2% glucose, tetracycline 0.0003%.
3. Transformation of the amplicon obtained in the first step in the presence of the RedET recombinase, induced by 0.3% arabinose into liquid LB for 1 hour. To do this, a second electroporation of the cells expressing RedET by the deletion cassette is carried out and the colonies are selected on LB agar supplemented with 0.2% glucose, tetracycline 0.0003% and added with 0.3% L-arabinose and kanamycin 0.0015%.
4. The plasmid p707-Llpe (supplied in the Quick & Easy E. coli Gene Deletion Red® / ET® Recombination by Gene bridges kit) is transformed by electroporation according to the kit protocol. The cells are selected on LB agar supplemented with 0.2% glucose, tetracycline 0.0003% and added with 0.3% L-arabinose. A counter selection of the clones obtained is carried out by checking that they are no longer capable of growing on the same medium supplemented with kanamycin 0.0015%.
5. The strain obtained is called EQ.EC003: MG1655 AsucA Aedd-eda
c) Deletion of the gapA gene
The deletion of the gapA gene is carried out by homologous recombination and the use of the Quick & Easy E. coli Gene Deletion Red® / ET® Recombination Kit according to the protocol of the supplier Gene bridges.
1. Oligonucleotides designed to amplify an expression cassette for an ERT-PKG-gb2-neo-ERT resistance gene and having a 5 ′ sequence homologous on 50 nucleotides to the regions adjacent to the deletion locus, ie the coding phase of the gene (gapA) (GenBank: X02662.1) thus generating arms for recombination of the cassette on the bacterial genome.
2. The Escherichia coli K-12 strain, EQ.EC003 is transformed by electroporation with the plasmid pRedET according to the kit protocol. The colonies obtained are selected on rich medium LB complex agar 0.2% glucose, tetracycline 0.0003%.
3. The transformation of the amplicon obtained during the first step in the presence of the RedET recombinase which will be induced by arabinose 0.3% in liquid LB for 1 hour. To do this, a second electroporation of the cells expressing RedET by the deletion cassette is carried out and the colonies are selected on LB agar supplemented with 0.2% glycerol and pyruvate 0.3%, tetracycline 0.0003% and added with 0.3% L-arabinose and kanamycin 0.0015 %.
The deletions are verified by genotyping and sequencing and the name of the strains obtained is • EQ.EC002: MG1655 AsucA • EQ.EC003: MG 1655 AsucA Aedd-eda • EQ.EC004: MG1655 AsucA Aedd-eda AgapA :: kan
d) Integration of the engineering necessary for the fixation of CO2
For the recombinant expression of the various components of a RuBisCO type I in E. coli, the genes described in table 15 below are cloned in the form of a synthetic operon containing the genes described in table 16 below. .
Table 15: genes coding for a RuBisCO type I
Genoa GenBank Organization rbcL BAD78320.1 Synechococcus elongatus rbcS BAD78319.1 Synechococcus elongatus rbcX BAD80711.1 Synechococcus elongatus Prk BAD78757.1 Synechococcus elongatus
Table 16: Composition of the expression cassettes
Plasmid Structure c e the synthetic operon in vector pZAll geneA RBS1 geneB RBS2 geneC RBS3 geneD RBS4 geneE pZAllpEQEC005 rbcS D rbcL B RbcX F pEQEC006 rbcS D rbcL B RbcX F Prk pEQEC008 Prk
To control the level of expression of these genes, ribosome binding sequences (RBS) presented in Table 17 below, having variable translation efficiencies 10 (Levin-Karp et al., ACS Synth Biol. 2013 Jun 21; 2 (6): 327-36. Doi: 10.1021 / sb400002n;
Zelcbuch et al., Nucleic Acids Res. 2013 May; 41 (9): e98) are inserted between the coding phase of each gene. The succession of each coding phase interspersed with an RBS sequence is constructed by successive insertions into a vector pZAll (Expressys) which contains a promoter PLtetO-1, an origin of average replication p15A and a gene for resistance to 15 Γ ampicillin.
Table 17: RBS intercistronic sequences
Last name RBS sequences A (SEQ ID N ° 9) AGGAGGTTTGGA B (SEQ. ID N ° 10) AACAAAATGAGGAGGTACTGAG C (SEQ. ID NO. Ll) AAGTTAAGAGGCAAGA D (SEQID N ° 12) TTCGCAGGGGGAAG E (SEQID N ° 13) TAAGCAGGACCGGCGGCG F (SEQID N ° 14) CACCATACACTG
Several strains are produced by electroporating the different vectors presented according to the plan above
EQ.EC 005 (EQ.EC 003+ pZAll): MG1655 sucA Aedd-eda
EQ.EC 006 ^ (EQ.EC 004+ pEQEC005): MG1655 AsucA Aedd-eda Δ gapA :: kan (RuBisCO)
EQ.EC 007 ^ (EQ.EC 004+ pEQEC006): MG1655 AsucA Aedd-eda Δ gapA :: kan (RuBisCO + PRK)
EQ.EC 009 ^ (EQ.EC 004+ pEQEC008): MG1655 AsucA Aedd-eda AgapA :: kan (PRK)
The clones are selected on LB medium supplemented with glycerol 2g / L and pyruvate 5g / L and with 100 mg / L of ampicillin. After obtaining a sufficient quantity of biomass, cultures of a volume greater than or equal to 50 ml in Erlenmeyer flask of at least 250 ml are seeded in order to adapt the strain to the use of PRK / RuBisCO engineering. This adaptation is carried out on the LB culture medium with 2 g / L of glucose, and an exogenous CO 2 supply at 37 ° C. as described above.
e) Glutamate production
For the production of glutamate, the cells from 500 ml of LB culture are inoculated in 20 ml of MS medium (40 g / L of glucose, 1 g / L MgSO ⁴ '. 7H2O, 20 g / L of (NH ₄ ) 2SO ₄ , 1 g / L KH2PO4, 10 mg / L EeSO ₄ .7H ₂ O, 10 mg / L MnSO ₄ .7H ₂ O, 2 g / L yeast extract, 30 g / L CaCO ³ , 100 mg / L of ampicillin at a pressure of 0.1 CO2 atmosphere.
The residual glutamate and glucose are measured with a bio analyzer (Sakura seiki). The carbon yield Y _p / _S is calculated in grams of glutamate produced per gram of glucose consumed.
This yield increases significantly by 10% for the strains EQ.EC 007 (RuBisCO + PRK) by comparison with the control strains EQ.EC 005 (empty), EQ.EC 006 (RuBisCO only). The control strain EQ.EC 009 (PRK alone) is not viable.
Example 5 Improvement in the Production of Polyhydroxybutyrate in C. necator
The increase in reducing power obtained thanks to the genetic modifications proposed according to the invention can also have a considerable gain on already existing metabolic pathways.
This is the case for the bacterial strain Cupriadus necator ATCC 17699 which naturally produces polyhydroxybutyrate (PHB). This bacterium is capable of developing both under autotrophy conditions and under heterotrophy conditions. Deletion of the gapA gene (glyceraldehyde-3-phosphate dehydrogenase NC_OO8313.1) makes it possible to divert the metabolic flow down the pathway of pentose phosphates and to increase the pool of reduced nucleotides NADPH making it possible to increase the production yield of PHB.
This C. necator H16 strain has a mega plasmid pHGl and two chromosomes. The deletion of the gapA gene is achieved by generating a vector containing a Sac A suicide gene for gram negative bacteria (Quandtet al., Gene. 1993 May 15; 127 (1): 15-21; Lindenkamp et al., Appl Environ Microbiol . 2010 Aug; 76 (16): 5373-82 and Appl Environ Microbiol. 2012 Aug; 78 (15): 5375-83).
a) Inactivation of the Entner-Doudoroff metabolic pathway
Two PCR amplicons corresponding to the adjacent regions of the edd and eda genes (upstream of edd and downstream of eda) are cloned by restriction according to the procedure described in Srinivasan et al. (Appl Environ Microbiol. 2002 Dec; 68 (12): 5925-32), in the plasmid pJQ200mpl8Cm.
The modified plasmid JQ200mpl8CmvAedd-eda is then transformed into an E. coli S17-1 strain by transformation using the calcium chloride method. The transfer of the genetic material is done by conjugation by depositing on an agar a culture depot of C. necator on a dish containing a cell mat of bacteria S17-1. The selection is made on NT medium (Nutrient browth) at 30 ° in the presence of 10% sucrose as selection (Hogrefe et al., J Bacteriol. 1984 Apr; 158 (l): 43-8) and validated on a medium mineral containing 50pg / ml chloramphenicol.
Deletions are validated by genotyping and sequencing. The strain EQCN_002 obtained is therefore deleted for the genes of the metabolic pathway from Entner-Doudoroff edd-eda. EQCN_002: H16 Aedd-eda./q Inactivation of the glycolysis pathway
Two PCR amplicons corresponding to the adjacent regions of the gapA gene are cloned by restriction according to the procedure described in Lindenkamp et al. 2012, in the plasmid pjQ200mpl8Tc.
The modified plasmid pjQ200mpl8Tc :: AgapA is then transformed into a strain ti'E.coli S17-1 by transformation by the method of calcium chloride. The transfer of the genetic material is done by conjugation by depositing on an agar a culture depot of C. necator on a dish containing a cell mat of bacteria S17-1. The selection is made on NT medium (Nutrient browth) at 30 ° in the presence of 10% sucrose as selection (Hogrefe et al., J Bacteriol. 1984 Apr; 158 (1): 43-8.) And validated on a mineral medium containing 25pg / ml tetracycline.
Deletions are validated by genotyping and sequencing. The EQCN_003 strain obtained is therefore deleted for the gapA gene. EQCN_003: H16 Aedd-eda AgapA.
The strain EQCN_003, deleted in the glycolytic pathway at the level of the gapA gene and in the Entner Doudoroff pathway at the level of the edd-eda genes is cultivated in order to improve the production yield of the PHB by fixing exogenous CO2 via the use PRK and RuBisCO enzymes.
b) Production of PHB in bioreactor
The inoculum from a frozen stock is spread on solid medium at a rate of 50 to 100 μL from a cryotube incubated at 30 ° C for 48 to 96 hours, in the presence of glucose. The expression of the genes coding for RuBisCO and PRK are maintained in C. necator under heterotrophic aerobic conditions (Rie Shimizuet al., Sci Rep. 2015; 5: 11617. Published online 2015 Jul I ·) ·
Cultures in batch mode carried out in Erlenmeyer flasks (10 ml in 50 ml, then 50 ml in 250 ml) are carried out with the appropriate culture medium, in glucose 20 g / L and a 10% supply of exogenous CO2 in a shaken incubator ( 100-200 RPM, 30 ° C), with a minimum inoculation of 0.01.
The strain of interest EQCN_003 improving the yield of production of PHB is compared to a reference strain H16 naturally accumulating PHB under heterotrophic conditions in the presence of a nutritional limitation.
The productivity of the strains is compared in bioreactors. The cultures carried out in bioreactors are seeded from solid and / or liquid amplification chains in Erlenmeyer flasks under the conditions described above. The bioreactors, of My-control type (Applikon Biotechnology, Delft, Netherlands) of 750ml or Biostat B (Sartorius Stedim, Goettingen, Germany) of 2.5L, are sown at a minimum concentration equivalent to 0.01 DO620nm.
The accumulation of PHB is decoupled from growth. The culture is regulated at 30 ° C, the aeration is between 0.1 WM (gas volume / liquid volume / min) and 1 WM in order to maintain a minimum concentration of dissolved oxygen greater than 20% (30 ° C, 1 bar), the agitation is adapted according to the scale of the bioreactor used. The input gas flow rate consists of air possibly supplemented with CO2. CO2 supplementation is between 1 and 10%. The pH is regulated to 7 with a 14 or 7% ammonia solution. The fed-batch culture mode allows a non-limiting supply of carbon substrate associated with a phosphorus or nitrogen limitation, while maintaining a constant carbon / phosphorus or carbon / nitrogen ratio. PHB extraction and quantification are carried out according to the method of Brandi et al. (Appl Environ Microbiol. 2013 Jul; 79 (14): 4433-9). The protocol consists in adding 1 ml of chloroform to 10 mg of lyophilized cells, followed by the addition of 850 μΐ of methanol and 150 μ1 of sulfuric acid. The mixture is heated 2.5 hours at 100 ° C., cooled and 500 μl of water are added. The two phases are separated by centrifugation and the organic phase is dried by the addition of sodium sulfate. The samples are filtered and analyzed as described by Millier et al. (Appl Environ Microbiol. 2013 Jul; 79 (14): 4433-9).
By comparing the wild C. necator cultures H16 and the strain EQCN_003: H16 Aedd-eda AgapA, there is an increase of 5% in the carbon yield, corresponding here to the ratio gram of PHB per gram of glucose consumed.

权利要求:
Claims (19)
[1" id="c-fr-0001]
1- Genetically modified microorganism expressing a functional RuBisCO enzyme and a phosphoribulokinase (PRK), and in which the glycolysis pathway is at least partially inhibited, said microorganism being genetically modified so as to produce an exogenous molecule and / or to overproduce a molecule endogenous.
[2" id="c-fr-0002]
2- Genetically modified microorganism according to claim 1, in which the oxidative branch of the pentose phosphate pathway is also at least partially inhibited.
[3" id="c-fr-0003]
3- Genetically modified microorganism according to claim 1 or 2, said microorganism being genetically modified to express a recombinant RuBisCO enzyme and / or PRK.
[4" id="c-fr-0004]
4- Genetically modified microorganism according to one of claims 1 to 3, said microorganism being genetically modified so as to inhibit glycolysis upstream of the production of 1,3-biphospho-D-glycerate (1,3-BPG) or in upstream of the production of 3phosphoglycerate (3PG), and downstream of the production of glyceraldehyde-3-phosphate (G3P).
[5" id="c-fr-0005]
5- Genetically modified microorganism according to one of claims 2 to 4, said microorganism being genetically modified so as to inhibit the oxidative branch of the pentose phosphate pathway upstream from the production of ribulose-5-phosphate.
[6" id="c-fr-0006]
6- Genetically modified microorganism according to claim 5, in which the exogenous molecule and / or the endogenous molecule is chosen from amino acids, peptides, proteins, vitamins, sterols, flavonoids, terpenes, terpenoids, fatty acids, polyols and organic acids.
[7" id="c-fr-0007]
7- Genetically modified microorganism according to one of claims 1 to 6, said microorganism being a eukaryotic cell, preferably chosen from yeasts, fungi, microalgae, or a prokaryotic cell, preferably a bacterium.
[8" id="c-fr-0008]
8- Genetically modified microorganism according to one of claims 1 to 7, in which the expression of the gene encoding glyceraldehyde 3-phosphate dehydrogenase is at least partially inhibited.
[9" id="c-fr-0009]
9- Genetically modified microorganism according to one of claims 1 to 8, in which the expression of the gene coding for phosphoglycerate kinase is at least partially inhibited.
[10" id="c-fr-0010]
10- Genetically modified microorganism according to claim 8 or 9, wherein the expression of the gene coding for glucose-6-phosphate dehydrogenase or 6phosphogluconolactonase or 6-phosphogluconate dehydrogenase is at least partially inhibited.
[11" id="c-fr-0011]
11- Genetically modified microorganism according to one of claims 1 to 10, said microorganism being a yeast of the genus Saccharomyces cerevisiae genetically modified to express a RuBisCO type I or II and a phosphoribulokinase (PRK) functional, and in which the expression of TDH1, TDH2 and / or TDH3 gene is at least partially inhibited.
[12" id="c-fr-0012]
12- Genetically modified microorganism according to one of claims 1 to 11, said microorganism being a yeast Saccharomyces cerevisiae genetically modified to express a RuBisCO type I or II and a phosphoribulokinase (PRK) functional, and in which the expression of the PGK1 gene is at least partially inhibited.
[13" id="c-fr-0013]
13- Genetically modified microorganism according to claim 11 or 12, in which the expression of the ZWF1 gene is at least partially inhibited.
[14" id="c-fr-0014]
14- Use of a genetically modified microorganism according to one of claims 1 to 13, for the production or overproduction of a molecule of interest, preferably chosen from amino acids, peptides, proteins, vitamins, sterols, flavonoids, terpenes, terpenoids, fatty acids, polyols and organic acids.
[15" id="c-fr-0015]
15- Biotechnological process for producing at least one molecule of interest, characterized in that it comprises a step of culturing a genetically modified microorganism according to one of claims 1 to 13, under conditions allowing the synthesis or bioconversion, by said microorganism, of said molecule of interest, and optionally a step of recovery and / or purification of said molecule of interest.
[16" id="c-fr-0016]
16. Biotechnological method according to claim 15, according to which the microorganism is genetically modified to express at least one enzyme involved in the bioconversion or the synthesis of said molecule of interest.
[17" id="c-fr-0017]
17- Biotechnological method according to claim 15 or 16, according to which the microorganism is genetically modified to at least partially inhibit an enzyme involved in the degradation of said molecule of interest.
[18" id="c-fr-0018]
18- A method of producing a molecule of interest comprising (i) the insertion of at least one sequence coding for an enzyme involved in the synthesis or bioconversion of said molecule of interest in a recombinant microorganism according to one of claims 1 to 13, (ii) culturing said microorganism under conditions allowing expression of said enzyme and optionally (iii) recovering and / or purifying said molecule of interest.
[19" id="c-fr-0019]
19- A method of producing a molecule of interest comprising (i) inhibiting the expression of at least one gene encoding an enzyme involved in the degradation of said molecule of interest in a recombinant microorganism according to one of claims 1 to 13, (ii) culturing said microorganism under conditions allowing expression of said enzyme and optionally (iii) recovering and / or purifying said molecule of interest.
1/3
Stacosis • e-phaiphata isomerase
Phosptofifuetokinaei »
Sucks
HwoMwase
Sfaeais®6-pliiosphate dfeihfaraeùiase fiADfH e <* ejpho · glaconolaeteeaw
SftiMseê-ptoïptate
I
FruaozeS-pTasphste atp!
I sfractow ·. · Ι>, · ι.
gtucaaa · factoiSÊ. ^f · .....
l-phospftnte ilolasé
Spàtaspitajiitcnnote
I fBiessebphmphate aldelase
I ·; .IF
Tphisspfteie _{Bmp î; ;;; : r} . J-pAesptate
ΤΗΜβ-phesphate, isomerase
GlycéraldÉhyde3-ph "sphete déshwdHiiin ·" ·
MADH
2.3 bipiiMpfrsÿipicVatc ·
Phosphojlyeérate | kinase j
AFP «4 d-ffàosphonMnss
PhMpknglïetaia mutase
2-phospIwÿfyefrate
PhotptMénolpiiruvate
Pyrwate kinase
ΛΡ * 4
Pyrwate * · "

类似技术:

---

公开号 | 公开日 | 专利标题

---

FR3062394A1|2018-08-03|GENETICALLY OPTIMIZED MICROORGANISM FOR THE PRODUCTION OF MOLECULES OF INTEREST

---

Tai et al.2013|Engineering the push and pull of lipid biosynthesis in oleaginous yeast Yarrowia lipolytica for biofuel production

---

US10006065B2|2018-06-26|Microbial engineering for the production of fatty acids and fatty acid derivatives

---

EP1680504B1|2011-10-19|Optimised micro-organism strains for nadph-consuming biosynthetic pathways

---

Beer et al.2009|Engineering algae for biohydrogen and biofuel production

---

US9862977B2|2018-01-09|Engineered microbes and methods for microbial oil production

---

US9879248B2|2018-01-30|Engineered microbes and methods for microbial oil overproduction from cellulosic materials

---

US11142770B2|2021-10-12|Isolated oleaginous yeast

---

JP6800019B2|2020-12-16|Biological production of methyl methacrylate

---

US20190359988A1|2019-11-28|Genetically optimised microorganism for producing molecules of interest

---

TWI535844B|2016-06-01|Production of n - Butanol Strain and Its Application

---

WO2019185861A1|2019-10-03|Modified microorganism with improved rubisco activity

---

Wang2014|Engineering cyanobacteria to convert carbon dioxide to building blocks for renewable plastics

同族专利:

---

公开号 | 公开日

---

BR112019015458A2|2020-03-31|

---

US20200277592A1|2020-09-03|

---

WO2018138289A1|2018-08-02|

---

KR20190115447A|2019-10-11|

---

EP3574083A1|2019-12-04|

---

FR3062394B1|2021-04-16|

---

CN110678541A|2020-01-10|

---

JP2020506723A|2020-03-05|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

WO2015107496A1|2014-01-16|2015-07-23|Institut National De La Recherche Agronomique|Yeasts modified to use carbon dioxide|

---

WO2015177800A2|2014-05-22|2015-11-26|Yeda Research And Development Co. Ltd.|Recombinant microorganisms capable of carbon fixation|

---

MX2015010875A|2013-02-22|2016-06-02|Univ Delft Tech|Recombinant micro-organism for use in method with increased product yield.|

---

BR112018074490A2|2016-06-14|2019-03-19|Dsm Ip Assets B.V.|recombinant yeast cell|

---

JP6917434B2|2019-10-25|2021-08-11|長瀬産業株式会社|Metabolic enzyme-disrupted strains of aerobic bacteria and their culture methods|

---

CN112941061B|2021-03-19|2021-09-07|中国农业大学|Tk-Rubisco mutant, linear assembly material, preparation method and application thereof|

法律状态:
2018-01-22| PLFP| Fee payment|Year of fee payment: 2 |

---

2018-08-03| PLSC| Search report ready|Effective date: 20180803 |

---

2020-01-30| PLFP| Fee payment|Year of fee payment: 4 |

---

2021-01-28| PLFP| Fee payment|Year of fee payment: 5 |

优先权:

---

申请号 | 申请日 | 专利标题

---

FR1750694|2017-01-27|

---

FR1750694A|FR3062394B1|2017-01-27|2017-01-27|GENETICALLY OPTIMIZED MICROORGANISM FOR THE PRODUCTION OF MOLECULES OF INTEREST|FR1750694A| FR3062394B1|2017-01-27|2017-01-27|GENETICALLY OPTIMIZED MICROORGANISM FOR THE PRODUCTION OF MOLECULES OF INTEREST|

---

KR1020197024086A| KR20190115447A|2017-01-27|2018-01-26|Gene-Optimized Microorganisms for the Generation of Target Molecules|

---

BR112019015458-2A| BR112019015458A2|2017-01-27|2018-01-26|GENETICALLY OPTIMIZED MICRO-ORGANISM TO PRODUCE MOLECULES OF INTEREST|

---

JP2019561349A| JP2020506723A|2017-01-27|2018-01-26|Genetically optimized microorganisms for producing target molecules|

---

PCT/EP2018/052005| WO2018138289A1|2017-01-27|2018-01-26|Genetically optimised microorganism for producing molecules of interest|

---

EP18702647.1A| EP3574083A1|2017-01-27|2018-01-26|Genetically optimised microorganism for producing molecules of interest|

---

CN201880021659.1A| CN110678541A|2017-01-27|2018-01-26|Genetically optimized microorganisms for producing molecules of interest|

---

US16/480,569| US20200277592A1|2017-01-27|2018-01-26|Genetically optimised microorganism for producing molecules of interest|